Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing hmcA gene

Properties
Regulog: HmcR - Desulfovibrionales
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode:
Biological process: Energy metabolism
Effector:
Phylum: Proteobacteria/delta
Built upon 12 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Desulfohalobium retbaense DSM 5692
Position: -158
Score: 5.06
Sequence: TCGCCTACTCAGCCGGTAGGTTT
Position: -133
Score: 5.49097
Sequence: ATACCTACCACTGAAGTAGGATT
Locus tag: Dret_0877
Name: hmcA
Funciton: High-molecular-weight cytochrome c precursor
Locus tag: Dret_0876
Name: hmcB
Funciton: 4Fe-4S ferredoxin iron-sulfur binding domain protein
Locus tag: Dret_0875
Name: hmcC
Funciton: Ni/Fe-hydrogenase 2 B-type cytochrome subunit
Locus tag: Dret_0874
Name: hmcD
Funciton: hmc operon protein 4
Locus tag: Dret_0873
Name: hmcE
Funciton: hmc operon protein 5
Locus tag: Dret_0872
Name: hmcF
Funciton: protein of unknown function DUF224 cysteine-rich region domain protein
Locus tag: Dret_0871
Name: null
Funciton: Universal stress protein family
Locus tag: Dret_0870
Name: null
Funciton: response regulator receiver protein
Locus tag: Dret_0869
Name: null
Funciton: response regulator receiver protein
Locus tag: Dret_0868
Name: null
Funciton: multi-sensor signal transduction histidine kinase
Locus tag: Dret_0867
Name: hmcR
Funciton: Transcriptional regulator, BadM/Rrf2 family
hmcA-hmcB-hmcC-hmcD-hmcE-hmcF-Dret_0871-Dret_0870-Dret_0869-Dret_0868-hmcR -158 5.1 TCGCCTACTCAGCCGGTAGGTTT Dret_0877
-133 5.5 ATACCTACCACTGAAGTAGGATT
Desulfomicrobium baculatum DSM 4028
Position: -194
Score: 4.58292
Sequence: TTCTATACCTCCGAGGTCGGAAT
Locus tag: Dbac_0568
Name: hmcA
Funciton: High-molecular-weight cytochrome c precursor
Locus tag: Dbac_0569
Name: hmcB
Funciton: 4Fe-4S ferredoxin iron-sulfur binding domain protein
Locus tag: Dbac_0570
Name: hmcC
Funciton: Ni/Fe-hydrogenase 2 B-type cytochrome subunit
Locus tag: Dbac_0571
Name: hmcD
Funciton: hmc operon protein 4
Locus tag: Dbac_0572
Name: hmcE
Funciton: hmc operon protein 5
Locus tag: Dbac_0573
Name: hmcF
Funciton: protein of unknown function DUF224 cysteine-rich region domain protein
Locus tag: Dbac_0574
Name: null
Funciton: Universal stress protein family
Locus tag: Dbac_0575
Name: null
Funciton: response regulator receiver protein
Locus tag: Dbac_0576
Name: null
Funciton: multi-sensor signal transduction histidine kinase
Locus tag: Dbac_0577
Name: hmcR
Funciton: Transcriptional regulator, BadM/Rrf2 family
hmcA-hmcB-hmcC-hmcD-hmcE-hmcF-Dbac_0574-Dbac_0575-Dbac_0576-hmcR -194 4.6 TTCTATACCTCCGAGGTCGGAAT Dbac_0568
Desulfovibrio desulfuricans G20
Position: -291
Score: 5.99331
Sequence: TCGCATACCTCAGCGGTAGGAAA
Position: -266
Score: 5.4984
Sequence: AATCATACCATGCAGGTAGGGTA
Locus tag: Dde_0653
Name: hmcA
Funciton: High-molecular-weight cytochrome c precursor
Locus tag: Dde_0652
Name: hmcB
Funciton: 4Fe-4S ferredoxin iron-sulfur binding domain protein
Locus tag: Dde_0651
Name: hmcC
Funciton: Ni/Fe-hydrogenase 2 B-type cytochrome subunit
Locus tag: Dde_0650
Name: hmcD
Funciton: hmc operon protein 4
Locus tag: Dde_0649
Name: hmcE
Funciton: hmc operon protein 5
Locus tag: Dde_0648
Name: hmcF
Funciton: protein of unknown function DUF224 cysteine-rich region domain protein
Locus tag: Dde_0647
Name: hmcR
Funciton: Transcriptional regulator, BadM/Rrf2 family
hmcA-hmcB-hmcC-hmcD-hmcE-hmcF-hmcR -291 6 TCGCATACCTCAGCGGTAGGAAA Dde_0653
-266 5.5 AATCATACCATGCAGGTAGGGTA
Desulfovibrio salexigens DSM 2638
Position: -226
Score: 5.53272
Sequence: TAACATACCTATCGAGCAGGTAT
Position: -201
Score: 4.74125
Sequence: AAACCTATCTATTGAGGAGGTAT
Position: -176
Score: 4.51788
Sequence: ATACCAACCCGATGGATGGGAAA
Locus tag: Desal_1378
Name: hmcA
Funciton: High-molecular-weight cytochrome c precursor
Locus tag: Desal_1377
Name: hmcB
Funciton: 4Fe-4S ferredoxin iron-sulfur binding domain protein
Locus tag: Desal_1376
Name: hmcC
Funciton: Ni/Fe-hydrogenase 2 B-type cytochrome subunit
Locus tag: Desal_1375
Name: hmcD
Funciton: hmc operon protein 4
Locus tag: Desal_1374
Name: hmcE
Funciton: hmc operon protein 5
Locus tag: Desal_1373
Name: hmcF
Funciton: protein of unknown function DUF224 cysteine-rich region domain protein
Locus tag: Desal_1372
Name: null
Funciton: Universal stress protein family
Locus tag: Desal_1371
Name: null
Funciton: response regulator receiver protein
Locus tag: Desal_1370
Name: null
Funciton: response regulator receiver protein
Locus tag: Desal_1369
Name: null
Funciton: multi-sensor signal transduction histidine kinase
Locus tag: Desal_1368
Name: hmcR
Funciton: Transcriptional regulator, BadM/Rrf2 family
hmcA-hmcB-hmcC-hmcD-hmcE-hmcF-Desal_1372-Desal_1371-Desal_1370-Desal_1369-hmcR -226 5.5 TAACATACCTATCGAGCAGGTAT Desal_1378
-201 4.7 AAACCTATCTATTGAGGAGGTAT
-176 4.5 ATACCAACCCGATGGATGGGAAA
Desulfovibrio vulgaris Hildenborough
Position: -210
Score: 5.82369
Sequence: TAGCATACCCCCGCAGTAGGATT
Position: -185
Score: 5.54755
Sequence: TTCCATACTATACAGGTAGGGTA
Locus tag: DVU0536
Name: hmcA
Funciton: High-molecular-weight cytochrome c precursor
Locus tag: DVU0535
Name: hmcB
Funciton: 4Fe-4S ferredoxin iron-sulfur binding domain protein
Locus tag: DVU0534
Name: hmcC
Funciton: Ni/Fe-hydrogenase 2 B-type cytochrome subunit
Locus tag: DVU0533
Name: hmcD
Funciton: hmc operon protein 4
Locus tag: DVU0532
Name: hmcE
Funciton: hmc operon protein 5
Locus tag: DVU0531
Name: hmcF
Funciton: protein of unknown function DUF224 cysteine-rich region domain protein
Locus tag: DVU0530
Name: rrf1
Funciton: response regulator, rrf1 protein
Locus tag: DVU0529
Name: hmcR
Funciton: Transcriptional regulator, BadM/Rrf2 family
hmcA-hmcB-hmcC-hmcD-hmcE-hmcF-rrf1-hmcR -210 5.8 TAGCATACCCCCGCAGTAGGATT DVU0536
-185 5.5 TTCCATACTATACAGGTAGGGTA
Desulfovibrio vulgaris str. Miyazaki F
Position: -346
Score: 6.00332
Sequence: TCGCATACCCCTCCGGTAGGAAT
Position: -321
Score: 5.915
Sequence: TTCCATACCCTAGAAGTAGGGTA
Locus tag: DvMF_2598
Name: hmcA
Funciton: High-molecular-weight cytochrome c precursor
Locus tag: DvMF_2597
Name: hmcB
Funciton: 4Fe-4S ferredoxin iron-sulfur binding domain protein
Locus tag: DvMF_2596
Name: hmcC
Funciton: Ni/Fe-hydrogenase 2 B-type cytochrome subunit
Locus tag: DvMF_2595
Name: hmcD
Funciton: hmc operon protein 4
Locus tag: DvMF_2594
Name: hmcE
Funciton: hmc operon protein 5
Locus tag: DvMF_2593
Name: hmcF
Funciton: protein of unknown function DUF224 cysteine-rich region domain protein
Locus tag: DvMF_2592
Name: null
Funciton: response regulator, rrf1 protein
Locus tag: DvMF_2591
Name: hmcR
Funciton: Transcriptional regulator, BadM/Rrf2 family
hmcA-hmcB-hmcC-hmcD-hmcE-hmcF-DvMF_2592-hmcR -346 6 TCGCATACCCCTCCGGTAGGAAT DvMF_2598
-321 5.9 TTCCATACCCTAGAAGTAGGGTA
© 2009-2020 RegPrecise