Orthologous regulated operons containing Desal_0830 gene
| Regulog: | OhcR - Desulfovibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | Fis |
| Regulation mode: | |
| Biological process: | Energy metabolism |
| Effector: | |
| Phylum: | Proteobacteria/delta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Desulfovibrio desulfuricans G20 | ||||
|
Position: -190
Score: 4.73159 Sequence: ACATATGTCTAACCATATGA
Position: -178
Score: 4.58814 Sequence: CCATATGATTAGACATTATC
Locus tag: Dde_0657
Name: null Funciton: iron-sulfur cluster-binding protein
Locus tag: Dde_0656
Name: Desal_0830 Funciton: iron-sulfur cluster-binding protein |
||||
| Dde_0657-Desal_0830 | -190 | 4.7 | ACATATGTCTAACCATATGA | Dde_0657 |
| -178 | 4.6 | CCATATGATTAGACATTATC | ||
| Desulfovibrio salexigens DSM 2638 | ||||
|
Position: -201
Score: 5.3347 Sequence: ACATGTGTTTAATCATGTGT
Locus tag: Desal_0829
Name: null Funciton: iron-sulfur cluster-binding protein
Locus tag: Desal_0830
Name: Desal_0830 Funciton: iron-sulfur cluster-binding protein
Locus tag: Desal_0831
Name: null Funciton: cytochrome c family protein
Locus tag: Desal_0832
Name: ohcC Funciton: Cytochrome B561 |
||||
| Desal_0829-Desal_0830-Desal_0831-ohcC | -201 | 5.3 | ACATGTGTTTAATCATGTGT | Desal_0829 |