Orthologous regulated operons containing nrtR gene
| Regulog: | NrtR - Chloroflexia |
| Regulator type: | Transcription factor |
| Regulator family: | NrtR |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | Adenosine diphosphate ribose |
| Phylum: | Chloroflexi |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Chloroflexus aggregans DSM 9485 | ||||
|
Position: -47
Score: 6.02726 Sequence: TTAGTGTATTACTAACACTAA
Locus tag: Cagg_0305
Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR |
||||
| nrtR | -47 | 6 | TTAGTGTATTACTAACACTAA | Cagg_0305 |
| Chloroflexus sp. Y-400-fl | ||||
|
Position: -47
Score: 6.12799 Sequence: TTAGTGTATAAATAACACTAA
Locus tag: Chy400_3450
Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR |
||||
| nrtR | -47 | 6.1 | TTAGTGTATAAATAACACTAA | Chy400_3450 |
| Herpetosiphon aurantiacus ATCC 23779 | ||||
|
Position: -32
Score: 5.95704 Sequence: TTTGTGTCATAATAACACTAT
Locus tag: Haur_4290
Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR
Locus tag: Haur_4289
Name: nadE Funciton: NAD synthetase (EC 6.3.1.5)
Locus tag: Haur_4288
Name: pncA Funciton: Nicotinamidase (EC 3.5.1.19) |
||||
| nrtR-nadE-pncA | -32 | 6 | TTTGTGTCATAATAACACTAT | Haur_4290 |
| Roseiflexus castenholzii DSM 13941 | ||||
|
Position: -70
Score: 5.70722 Sequence: TTATTGTTGTAATGACACTAA
Locus tag: Rcas_0387
Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR
Locus tag: Rcas_0388
Name: pncA Funciton: Nicotinamidase (EC 3.5.1.19) |
||||
| nrtR-pncA | -70 | 5.7 | TTATTGTTGTAATGACACTAA | Rcas_0387 |
| Roseiflexus sp. RS-1 | ||||
|
Position: -34
Score: 5.53802 Sequence: TTATTGTTGCAATGACACTAA
Locus tag: RoseRS_0145
Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR
Locus tag: RoseRS_0144
Name: pncA Funciton: Nicotinamidase (EC 3.5.1.19) |
||||
| nrtR-pncA | -34 | 5.5 | TTATTGTTGCAATGACACTAA | RoseRS_0145 |