Orthologous regulated operons containing recX gene

Properties
Regulog:	LexA - Various betaproteobacteria
Regulator type:	Transcription factor
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Phylum:	Proteobacteria/beta

Built upon 12 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Dechloromonas aromatica RCB
Position: -146 Score: 5.81546 Sequence: TACTGTATTTATACACAGTA Locus tag: Daro_4152 Name: recA Funciton: Recombinase A Locus tag: Daro_4151 Name: recX Funciton: Regulatory protein RecX
recA-recX	-146	5.8	TACTGTATTTATACACAGTA	Daro_4152

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --