Orthologous regulated operons containing recX gene
Regulog: | LexA - Various betaproteobacteria |
Regulator type: | Transcription factor |
Regulator family: | LexA |
Regulation mode: | repressor |
Biological process: | SOS response |
Effector: | DNA damage |
Phylum: | Proteobacteria/beta |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Dechloromonas aromatica RCB | ||||
Position: -146
Score: 5.81546 Sequence: TACTGTATTTATACACAGTA
Locus tag: Daro_4152
Name: recA Funciton: Recombinase A
Locus tag: Daro_4151
Name: recX Funciton: Regulatory protein RecX |
||||
recA-recX | -146 | 5.8 | TACTGTATTTATACACAGTA | Daro_4152 |