Orthologous regulated operons containing recA gene
| Regulog: | LexA - Various betaproteobacteria |
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Dechloromonas aromatica RCB | ||||
|
Position: -146
Score: 5.81546 Sequence: TACTGTATTTATACACAGTA
Locus tag: Daro_4152
Name: recA Funciton: Recombinase A
Locus tag: Daro_4151
Name: recX Funciton: Regulatory protein RecX |
||||
| recA-recX | -146 | 5.8 | TACTGTATTTATACACAGTA | Daro_4152 |