Orthologous regulated operons containing imuB gene
| Regulog: | LexA - Various betaproteobacteria |
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Azoarcus sp. EbN1 | ||||
|
Position: -82
Score: 5.74648 Sequence: ATGTGTATAAATATACAGCA
Locus tag: ebA3086
Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
Locus tag: ebA3084
Name: imuA Funciton: Predicted RecA/RadA recombinase
Locus tag: ebA3079
Name: imuB Funciton: DNA polymerase-like protein PA0670
Locus tag: ebA3077
Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7) |
||||
| lexA-imuA-imuB-dnaE2 | -82 | 5.7 | ATGTGTATAAATATACAGCA | ebA3086 |
| Dechloromonas aromatica RCB | ||||
|
Position: -44
Score: 6.1293 Sequence: TACTGTACAAAAATACAGTC
Locus tag: Daro_1939
Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
Locus tag: Daro_1940
Name: imuA Funciton: Predicted RecA/RadA recombinase
Locus tag: Daro_1941
Name: imuB Funciton: DNA polymerase-like protein PA0670
Locus tag: Daro_1942
Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7) |
||||
| lexA-imuA-imuB-dnaE2 | -44 | 6.1 | TACTGTACAAAAATACAGTC | Daro_1939 |
| Thauera sp. MZ1T | ||||
|
Position: -37
Score: 5.86775 Sequence: GACTGTTTAAAATTACAGCC
Locus tag: Tmz1t_2297
Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
Locus tag: Tmz1t_2298
Name: imuA Funciton: Predicted RecA/RadA recombinase
Locus tag: Tmz1t_2299
Name: imuB Funciton: DNA polymerase-like protein PA0670 |
||||
| lexA-imuA-imuB | -37 | 5.9 | GACTGTTTAAAATTACAGCC | Tmz1t_2297 |
| Thiobacillus denitrificans | ||||
|
Position: -192
Score: 5.91029 Sequence: TACTGTATAAATCAACAGTA
Locus tag: Tbd_0830
Name: imuA Funciton: Predicted RecA/RadA recombinase
Locus tag: Tbd_0829
Name: imuB Funciton: DNA polymerase-like protein PA0670
Locus tag: Tbd_0828
Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
Locus tag: Tbd_0827
Name: dnaQ Funciton: DNA polymerase III epsilon subunit (EC 2.7.7.7) |
||||
| imuA-imuB-dnaE2-dnaQ | -192 | 5.9 | TACTGTATAAATCAACAGTA | Tbd_0830 |