Orthologous regulated operons containing dnaQ gene

Properties
Regulog:	LexA - Various betaproteobacteria
Regulator type:	Transcription factor
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Phylum:	Proteobacteria/beta

Built upon 12 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Thiobacillus denitrificans
Position: -192 Score: 5.91029 Sequence: TACTGTATAAATCAACAGTA Locus tag: Tbd_0830 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: Tbd_0829 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: Tbd_0828 Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7) Locus tag: Tbd_0827 Name: dnaQ Funciton: DNA polymerase III epsilon subunit (EC 2.7.7.7)
imuA-imuB-dnaE2-dnaQ	-192	5.9	TACTGTATAAATCAACAGTA	Tbd_0830

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --