Orthologous regulated operons containing dinB gene
| Regulog: | LexA - Ralstonia |
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Ralstonia metallidurans CH34 | ||||
|
Position: -40
Score: 6.11225 Sequence: TACTGTACGTTTATACAGTA
Locus tag: Rmet_3545
Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7) |
||||
| dinB | -40 | 6.1 | TACTGTACGTTTATACAGTA | Rmet_3545 |