Orthologous regulated operons containing PF04055 gene
| Regulog: | LexA - Ralstonia |
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Ralstonia eutropha H16 | ||||
|
Position: -44
Score: 6.47447 Sequence: TACTGTATATATATACAGTG
Locus tag: H16_A0887
Name: PF04055 Funciton: DNA repair photolyase |
||||
| PF04055 | -44 | 6.5 | TACTGTATATATATACAGTG | H16_A0887 |
| Ralstonia metallidurans CH34 | ||||
|
Position: -48
Score: 6.54765 Sequence: TACTGTATATTTATACAGTA
Locus tag: Rmet_0742
Name: PF04055 Funciton: DNA repair photolyase |
||||
| PF04055 | -48 | 6.5 | TACTGTATATTTATACAGTA | Rmet_0742 |