Orthologous regulated operons containing dinD gene
| Regulog: | LexA - Ralstonia |
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Cupriavidus taiwanensis | ||||
|
Position: -68
Score: 6.28382 Sequence: CACTGTATATTCATACAGTA
Locus tag: RALTA_A3210
Name: dinD Funciton: DNA-damage-inducible protein, part of SOS response |
||||
| dinD | -68 | 6.3 | CACTGTATATTCATACAGTA | RALTA_A3210 |