Orthologous regulated operons containing PF06733 gene
Regulog: | LexA - Ralstonia |
Regulator type: | Transcription factor |
Regulator family: | LexA |
Regulation mode: | repressor |
Biological process: | SOS response |
Effector: | DNA damage |
Phylum: | Proteobacteria/beta |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Cupriavidus taiwanensis | ||||
Position: -88
Score: 6.18192 Sequence: TACTGTATATTTGTACAGTT
Locus tag: RALTA_B1170
Name: PF06733 Funciton: DinG family ATP-dependent helicase CPE1197 |
||||
PF06733 | -88 | 6.2 | TACTGTATATTTGTACAGTT | RALTA_B1170 |
Ralstonia eutropha H16 | ||||
Position: -103
Score: 6.27911 Sequence: TACTGTATATTCATACAGTT
Locus tag: H16_B1265
Name: PF06733 Funciton: DinG family ATP-dependent helicase CPE1197 |
||||
PF06733 | -103 | 6.3 | TACTGTATATTCATACAGTT | H16_B1265 |
Ralstonia eutropha JMP134 | ||||
Position: -44
Score: 6.10187 Sequence: GACTGTATATTCATACAGTT
Locus tag: Reut_B5827
Name: PF06733 Funciton: DinG family ATP-dependent helicase CPE1197 |
||||
PF06733 | -44 | 6.1 | GACTGTATATTCATACAGTT | Reut_B5827 |