Orthologous regulated operons containing H16_B2553 gene
Regulog: | LexA - Ralstonia |
Regulator type: | Transcription factor |
Regulator family: | LexA |
Regulation mode: | repressor |
Biological process: | SOS response |
Effector: | DNA damage |
Phylum: | Proteobacteria/beta |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Cupriavidus taiwanensis | ||||
Position: -42
Score: 6.04477 Sequence: GACTGTATATTCGTACAGTA
Locus tag: RALTA_B2284
Name: H16_B2553 Funciton: Conserved hypothetical protein |
||||
H16_B2553 | -42 | 6 | GACTGTATATTCGTACAGTA | RALTA_B2284 |
Ralstonia eutropha H16 | ||||
Position: -51
Score: 6.04477 Sequence: GACTGTATATTCGTACAGTA
Locus tag: H16_B2553
Name: H16_B2553 Funciton: Conserved hypothetical protein |
||||
H16_B2553 | -51 | 6 | GACTGTATATTCGTACAGTA | H16_B2553 |
Ralstonia eutropha JMP134 | ||||
Position: -51
Score: 6.04477 Sequence: GACTGTATATTCGTACAGTA
Locus tag: Reut_B5317
Name: H16_B2553 Funciton: Conserved hypothetical protein |
||||
H16_B2553 | -51 | 6 | GACTGTATATTCGTACAGTA | Reut_B5317 |
Ralstonia metallidurans CH34 | ||||
Position: -42
Score: 6.26715 Sequence: CACTGTATATTTATACAGTG
Locus tag: Rmet_5910
Name: H16_B2553 Funciton: Conserved hypothetical protein |
||||
H16_B2553 | -42 | 6.3 | CACTGTATATTTATACAGTG | Rmet_5910 |