Orthologous regulated operons containing uvrA gene
Regulog: | LexA - Ralstonia |
Regulator type: | Transcription factor |
Regulator family: | LexA |
Regulation mode: | repressor |
Biological process: | SOS response |
Effector: | DNA damage |
Phylum: | Proteobacteria/beta |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Cupriavidus taiwanensis | ||||
Position: -71
Score: 5.74147 Sequence: GACTGTATGGATGTACAGTG
Locus tag: RALTA_B1379
Name: uvrA Funciton: Excinuclease ABC subunit A |
||||
uvrA | -71 | 5.7 | GACTGTATGGATGTACAGTG | RALTA_B1379 |
Ralstonia eutropha H16 | ||||
Position: -72
Score: 5.74147 Sequence: GACTGTATGGATGTACAGTG
Locus tag: H16_B1571
Name: uvrA Funciton: Excinuclease ABC subunit A |
||||
uvrA | -72 | 5.7 | GACTGTATGGATGTACAGTG | H16_B1571 |
Ralstonia eutropha JMP134 | ||||
Position: -160
Score: 5.55769 Sequence: CACTGTACGGATATACAGTC
Locus tag: Reut_B4240
Name: uvrA Funciton: Excinuclease ABC subunit A |
||||
uvrA | -160 | 5.6 | CACTGTACGGATATACAGTC | Reut_B4240 |
Ralstonia metallidurans CH34 | ||||
Position: -150
Score: 6.11599 Sequence: CACTGTATGTTCATACAGTA
Locus tag: Rmet_4549
Name: uvrA Funciton: Excinuclease ABC subunit A |
||||
uvrA | -150 | 6.1 | CACTGTATGTTCATACAGTA | Rmet_4549 |