Orthologous regulated operons containing recA gene

Properties
Regulog:	LexA - Ralstonia
Regulator type:	Transcription factor
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Phylum:	Proteobacteria/beta

Built upon 62 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Cupriavidus taiwanensis
Position: -159 Score: 6.06005 Sequence: TACTGTTTTTTTATACAGTA Locus tag: RALTA_A0499 Name: recA Funciton: Recombinase A Locus tag: RALTA_A0500 Name: recX Funciton: Regulatory protein RecX
recA-recX	-159	6.1	TACTGTTTTTTTATACAGTA	RALTA_A0499
Ralstonia eutropha H16
Position: -159 Score: 6.06005 Sequence: TACTGTTTTTTTATACAGTA Locus tag: H16_A0544 Name: recA Funciton: Recombinase A Locus tag: H16_A0545 Name: recX Funciton: Regulatory protein RecX
recA-recX	-159	6.1	TACTGTTTTTTTATACAGTA	H16_A0544
Ralstonia eutropha JMP134
Position: -194 Score: 6.06005 Sequence: TACTGTTTTTTTATACAGTA Locus tag: Reut_A0527 Name: recA Funciton: Recombinase A Locus tag: Reut_A0528 Name: recX Funciton: Regulatory protein RecX
recA-recX	-194	6.1	TACTGTTTTTTTATACAGTA	Reut_A0527
Ralstonia metallidurans CH34
Position: -171 Score: 6.06005 Sequence: TACTGTTTTTTTATACAGTA Locus tag: Rmet_0466 Name: recA Funciton: Recombinase A Locus tag: Rmet_0467 Name: recX Funciton: Regulatory protein RecX
recA-recX	-171	6.1	TACTGTTTTTTTATACAGTA	Rmet_0466
Ralstonia pickettii 12J
Position: -172 Score: 5.45985 Sequence: CACTGGTTTTTTATACAGTA Locus tag: Rpic_0471 Name: recA Funciton: Recombinase A Locus tag: Rpic_0472 Name: recX Funciton: Regulatory protein RecX
recA-recX	-172	5.5	CACTGGTTTTTTATACAGTA	Rpic_0471
Ralstonia solanacearum GMI1000
Position: -180 Score: 5.45985 Sequence: CACTGGTTTTTTATACAGTA Locus tag: RSc0551 Name: recA Funciton: Recombinase A Locus tag: RSc0552 Name: recX Funciton: Regulatory protein RecX
recA-recX	-180	5.5	CACTGGTTTTTTATACAGTA	RSc0551