Orthologous regulated operons containing recA gene
Regulog: | LexA - Ralstonia |
Regulator type: | Transcription factor |
Regulator family: | LexA |
Regulation mode: | repressor |
Biological process: | SOS response |
Effector: | DNA damage |
Phylum: | Proteobacteria/beta |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Cupriavidus taiwanensis | ||||
Position: -159
Score: 6.06005 Sequence: TACTGTTTTTTTATACAGTA
Locus tag: RALTA_A0499
Name: recA Funciton: Recombinase A
Locus tag: RALTA_A0500
Name: recX Funciton: Regulatory protein RecX |
||||
recA-recX | -159 | 6.1 | TACTGTTTTTTTATACAGTA | RALTA_A0499 |
Ralstonia eutropha H16 | ||||
Position: -159
Score: 6.06005 Sequence: TACTGTTTTTTTATACAGTA
Locus tag: H16_A0544
Name: recA Funciton: Recombinase A
Locus tag: H16_A0545
Name: recX Funciton: Regulatory protein RecX |
||||
recA-recX | -159 | 6.1 | TACTGTTTTTTTATACAGTA | H16_A0544 |
Ralstonia eutropha JMP134 | ||||
Position: -194
Score: 6.06005 Sequence: TACTGTTTTTTTATACAGTA
Locus tag: Reut_A0527
Name: recA Funciton: Recombinase A
Locus tag: Reut_A0528
Name: recX Funciton: Regulatory protein RecX |
||||
recA-recX | -194 | 6.1 | TACTGTTTTTTTATACAGTA | Reut_A0527 |
Ralstonia metallidurans CH34 | ||||
Position: -171
Score: 6.06005 Sequence: TACTGTTTTTTTATACAGTA
Locus tag: Rmet_0466
Name: recA Funciton: Recombinase A
Locus tag: Rmet_0467
Name: recX Funciton: Regulatory protein RecX |
||||
recA-recX | -171 | 6.1 | TACTGTTTTTTTATACAGTA | Rmet_0466 |
Ralstonia pickettii 12J | ||||
Position: -172
Score: 5.45985 Sequence: CACTGGTTTTTTATACAGTA
Locus tag: Rpic_0471
Name: recA Funciton: Recombinase A
Locus tag: Rpic_0472
Name: recX Funciton: Regulatory protein RecX |
||||
recA-recX | -172 | 5.5 | CACTGGTTTTTTATACAGTA | Rpic_0471 |
Ralstonia solanacearum GMI1000 | ||||
Position: -180
Score: 5.45985 Sequence: CACTGGTTTTTTATACAGTA
Locus tag: RSc0551
Name: recA Funciton: Recombinase A
Locus tag: RSc0552
Name: recX Funciton: Regulatory protein RecX |
||||
recA-recX | -180 | 5.5 | CACTGGTTTTTTATACAGTA | RSc0551 |