Orthologous regulated operons containing imuA gene

Properties
Regulog:	LexA - Ralstonia
Regulator type:	Transcription factor
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Phylum:	Proteobacteria/beta

Built upon 62 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Cupriavidus taiwanensis
Position: -72 Score: 6.34071 Sequence: TACTGTATAAATATACAGTT Locus tag: RALTA_B0872 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: RALTA_B0873 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: RALTA_B0874 Name: dnaE2 Funciton: macromolecule metabolism; macromolecule synthesis, modification; dna - replication, repair, restr./modif.
imuA-imuB-dnaE2	-72	6.3	TACTGTATAAATATACAGTT	RALTA_B0872
Ralstonia eutropha H16
Position: -72 Score: 6.34071 Sequence: TACTGTATAAATATACAGTT Locus tag: H16_B1060 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: H16_B1061 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: H16_B1062 Name: dnaE2 Funciton: macromolecule metabolism; macromolecule synthesis, modification; dna - replication, repair, restr./modif.
imuA-imuB-dnaE2	-72	6.3	TACTGTATAAATATACAGTT	H16_B1060
Ralstonia eutropha JMP134
Position: 91 Score: 6.34071 Sequence: TACTGTATAAATATACAGTT Locus tag: Reut_B4525 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: Reut_B4524 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: Reut_B4523 Name: dnaE2 Funciton: macromolecule metabolism; macromolecule synthesis, modification; dna - replication, repair, restr./modif.
imuA-imuB-dnaE2	91	6.3	TACTGTATAAATATACAGTT	Reut_B4525
Ralstonia metallidurans CH34
Position: -72 Score: 6.3808 Sequence: TACTGTATAAACATACAGTA Locus tag: Rmet_4128 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: Rmet_4129 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: Rmet_4130 Name: dnaE2 Funciton: macromolecule metabolism; macromolecule synthesis, modification; dna - replication, repair, restr./modif.
imuA-imuB-dnaE2	-72	6.4	TACTGTATAAACATACAGTA	Rmet_4128
Ralstonia pickettii 12J
Position: -44 Score: 6.43342 Sequence: TACTGTATATTCATACAGTA Locus tag: Rpic_4490 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: Rpic_4489 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: Rpic_4488 Name: dnaE2 Funciton: macromolecule metabolism; macromolecule synthesis, modification; dna - replication, repair, restr./modif.
imuA-imuB-dnaE2	-44	6.4	TACTGTATATTCATACAGTA	Rpic_4490
Ralstonia solanacearum GMI1000
Position: -159 Score: 6.16285 Sequence: TACTGTATATCCATACAGTA Locus tag: RS01909 Name: imuA Funciton: Predicted RecA/RadA recombinase Locus tag: RS01908 Name: imuB Funciton: DNA polymerase-like protein PA0670 Locus tag: RSp0800 Name: dnaE2 Funciton: macromolecule metabolism; macromolecule synthesis, modification; dna - replication, repair, restr./modif.
imuA-imuB-dnaE2	-159	6.2	TACTGTATATCCATACAGTA	RS01909