Orthologous regulated operons containing umuD gene
| Regulog: | LexA - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Alcanivorax borkumensis SK2 | ||||
|
Position: 20
Score: 5.3988 Sequence: TACTGTACATATAGGCAGTA
Locus tag: ABO_1583
Name: umuD Funciton: DNA polymerase V, subunit UmuD
Locus tag: ABO_1582
Name: umuC Funciton: DNA polymerase V, subunit UmuC |
||||
| umuD-umuC | 20 | 5.4 | TACTGTACATATAGGCAGTA | ABO_1583 |
| Marinobacter aqueolei | ||||
|
Position: -33
Score: 6.21868 Sequence: TACTGTATATTCAAACAGTA
Locus tag: Maqu_1208
Name: umuD Funciton: DNA polymerase V, subunit UmuD |
||||
| umuD | -33 | 6.2 | TACTGTATATTCAAACAGTA | Maqu_1208 |
| Marinomonas sp. MWYL1 | ||||
|
Position: -35
Score: 6.02799 Sequence: TACTGTATATCTATACAGTA
Locus tag: Mmwyl1_1981
Name: umuD Funciton: DNA polymerase V, subunit UmuD
Locus tag: Mmwyl1_1982
Name: umuC Funciton: DNA polymerase V, subunit UmuC |
||||
| umuD-umuC | -35 | 6 | TACTGTATATCTATACAGTA | Mmwyl1_1981 |
| Oceanospirillum sp. MED92 | ||||
|
Position: -34
Score: 6.454 Sequence: TACTGTATATAAATACAGTA
Locus tag: MED92_07246
Name: umuD Funciton: DNA polymerase V, subunit UmuD
Locus tag: MED92_07251
Name: umuC Funciton: DNA polymerase V, subunit UmuC |
||||
| umuD-umuC | -34 | 6.5 | TACTGTATATAAATACAGTA | MED92_07246 |