Orthologous regulated operons containing yebG gene
| Regulog: | LexA - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Hahella chejuensis KCTC 2396 | ||||
|
Position: -42
Score: 5.54789 Sequence: AACTGTATGAATATACAGAG
Locus tag: HCH_05148
Name: yebG Funciton: SOS regulon DNA damage-inducible protein |
||||
| yebG | -42 | 5.5 | AACTGTATGAATATACAGAG | HCH_05148 |
| Marinobacter aqueolei | ||||
|
Position: -88
Score: 6.05806 Sequence: TACTGTATAAATATACACTA
Locus tag: Maqu_2961
Name: yebG Funciton: SOS regulon DNA damage-inducible protein |
||||
| yebG | -88 | 6.1 | TACTGTATAAATATACACTA | Maqu_2961 |
| Marinobacter sp. ELB17 | ||||
|
Position: -120
Score: 6.06302 Sequence: AACTGTATATATAAACAGTG
Locus tag: MELB17_11410
Name: yebG Funciton: SOS regulon DNA damage-inducible protein |
||||
| yebG | -120 | 6.1 | AACTGTATATATAAACAGTG | MELB17_11410 |
| Marinomonas sp. MWYL1 | ||||
|
Position: -42
Score: 6.20674 Sequence: AACTGTATATTTATACAGTA
Locus tag: Mmwyl1_3691
Name: yebG Funciton: SOS regulon DNA damage-inducible protein |
||||
| yebG | -42 | 6.2 | AACTGTATATTTATACAGTA | Mmwyl1_3691 |
| Saccharophagus degradans 2-40 | ||||
|
Position: -46
Score: 5.27588 Sequence: TACTGTATACTCGTACAGCA
Locus tag: Sde_0674
Name: yebG Funciton: SOS regulon DNA damage-inducible protein |
||||
| yebG | -46 | 5.3 | TACTGTATACTCGTACAGCA | Sde_0674 |
| Teredinibacter turnerae T7901 | ||||
|
Position: -88
Score: 6.03377 Sequence: TACTGTACAAACAAACAGTA
Locus tag: TERTU_0430
Name: yebG Funciton: SOS regulon DNA damage-inducible protein |
||||
| yebG | -88 | 6 | TACTGTACAAACAAACAGTA | TERTU_0430 |