Orthologous regulated operons containing sulA gene
| Regulog: | LexA - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Cellvibrio japonicus Ueda107 | ||||
|
Position: -32
Score: 5.90669 Sequence: AACTGTATAAATACACAGAA
Locus tag: CJA_1697
Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
Locus tag: CJA_1696
Name: sulA Funciton: Cell division inhibitor sulA |
||||
| lexA-sulA | -32 | 5.9 | AACTGTATAAATACACAGAA | CJA_1697 |
| Marinobacter aqueolei | ||||
|
Position: -42
Score: 5.90997 Sequence: CACTGTATAAAAAAACAGGA
Locus tag: Maqu_2007
Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
Locus tag: Maqu_2006
Name: sulA Funciton: Cell division inhibitor sulA |
||||
| lexA-sulA | -42 | 5.9 | CACTGTATAAAAAAACAGGA | Maqu_2007 |
| Marinobacter sp. ELB17 | ||||
|
Position: -47
Score: 5.634 Sequence: CACTGTATAAACAAACAGGG
Locus tag: MELB17_18189
Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
Locus tag: MELB17_18184
Name: sulA Funciton: Cell division inhibitor sulA |
||||
| lexA-sulA | -47 | 5.6 | CACTGTATAAACAAACAGGG | MELB17_18189 |
| Oceanospirillum sp. MED92 | ||||
|
Position: -87
Score: 5.81849 Sequence: CACTGTATAAAAAAACATTA
Position: -28
Score: 5.88033 Sequence: TACTGTATAAACAACCAGAA
Locus tag: MED92_03977
Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
Locus tag: MED92_03972
Name: sulA Funciton: Cell division inhibitor sulA |
||||
| lexA-sulA | -87 | 5.8 | CACTGTATAAAAAAACATTA | MED92_03977 |
| -28 | 5.9 | TACTGTATAAACAACCAGAA | ||
| Reinekea sp. MED297 | ||||
|
Position: -30
Score: 5.67469 Sequence: TACTGTTTATTTATACAGGC
Locus tag: MED297_16639
Name: sulA Funciton: Cell division inhibitor sulA |
||||
| sulA | -30 | 5.7 | TACTGTTTATTTATACAGGC | MED297_16639 |
| Saccharophagus degradans 2-40 | ||||
|
Position: -41
Score: 5.33276 Sequence: TACTGTATATTCATCCAATC
Locus tag: Sde_1787
Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
Locus tag: Sde_1786
Name: sulA Funciton: Cell division inhibitor sulA |
||||
| lexA-sulA | -41 | 5.3 | TACTGTATATTCATCCAATC | Sde_1787 |
| Teredinibacter turnerae T7901 | ||||
|
Position: -75
Score: 6.06159 Sequence: TACTGTATAAACAAACAGAT
Locus tag: TERTU_1938
Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
Locus tag: TERTU_1937
Name: sulA Funciton: Cell division inhibitor sulA |
||||
| lexA-sulA | -75 | 6.1 | TACTGTATAAACAAACAGAT | TERTU_1938 |