Orthologous regulated operons containing dinB gene
| Regulog: | LexA - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Chromohalobacter salexigens DSM 3043 | ||||
|
Position: -40
Score: 4.83154 Sequence: TACTGTATACTTGAACACGT
Locus tag: Csal_2070
Name: lexA Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
Locus tag: Csal_2071
Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7) |
||||
| lexA-dinB | -40 | 4.8 | TACTGTATACTTGAACACGT | Csal_2070 |
| Marinobacter aqueolei | ||||
|
Position: -41
Score: 5.06033 Sequence: GGCTGTATAAACGTACAGAT
Locus tag: Maqu_2332
Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7) |
||||
| dinB | -41 | 5.1 | GGCTGTATAAACGTACAGAT | Maqu_2332 |
| Marinobacter sp. ELB17 | ||||
|
Position: -98
Score: 4.74778 Sequence: GGCTGTATGCATATACAGCG
Locus tag: MELB17_18524
Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7) |
||||
| dinB | -98 | 4.7 | GGCTGTATGCATATACAGCG | MELB17_18524 |
| Marinomonas sp. MWYL1 | ||||
|
Position: -37
Score: 5.30042 Sequence: AACTGTGTTTTTATACAGTA
Locus tag: Mmwyl1_3784
Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7) |
||||
| dinB | -37 | 5.3 | AACTGTGTTTTTATACAGTA | Mmwyl1_3784 |
| Oceanobacter sp. RED65 | ||||
|
Position: -28
Score: 5.73513 Sequence: CACTGTATGTTAATACAGTA
Locus tag: RED65_10319
Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7) |
||||
| dinB | -28 | 5.7 | CACTGTATGTTAATACAGTA | RED65_10319 |
| Oceanospirillum sp. MED92 | ||||
|
Position: -23
Score: 6.48342 Sequence: TACTGTATAAATAAACAGTA
Locus tag: MED92_14483
Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7) |
||||
| dinB | -23 | 6.5 | TACTGTATAAATAAACAGTA | MED92_14483 |
| Reinekea sp. MED297 | ||||
|
Position: -28
Score: 5.38738 Sequence: AACTGTATAAGCATACAGGT
Locus tag: MED297_03315
Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7) |
||||
| dinB | -28 | 5.4 | AACTGTATAAGCATACAGGT | MED297_03315 |
| Teredinibacter turnerae T7901 | ||||
|
Position: -68
Score: 6.02968 Sequence: AACTGTATAATAATACAGTA
Locus tag: TERTU_0718
Name: dinB Funciton: DNA polymerase IV (EC 2.7.7.7) |
||||
| dinB | -68 | 6 | AACTGTATAATAATACAGTA | TERTU_0718 |