Orthologous regulated operons containing imuB gene
| Regulog: | LexA - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Hahella chejuensis KCTC 2396 | ||||
|
Position: -62
Score: 5.45802 Sequence: TACTGATTTTATATACAGTA
Locus tag: HCH_02202
Name: imuA Funciton: Predicted RecA/RadA recombinase
Locus tag: HCH_02201
Name: imuB Funciton: DNA polymerase-like protein PA0670
Locus tag: HCH_02200
Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7) |
||||
| imuA-imuB-dnaE2 | -62 | 5.5 | TACTGATTTTATATACAGTA | HCH_02202 |
| Marinobacter aqueolei | ||||
|
Position: -34
Score: 6.53147 Sequence: TACTGTATATATAAACAGTA
Locus tag: Maqu_0975
Name: imuA Funciton: Predicted RecA/RadA recombinase
Locus tag: Maqu_0974
Name: imuB Funciton: DNA polymerase-like protein PA0670
Locus tag: Maqu_0973
Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7) |
||||
| imuA-imuB-dnaE2 | -34 | 6.5 | TACTGTATATATAAACAGTA | Maqu_0975 |
| Marinobacter sp. ELB17 | ||||
|
Position: -35
Score: 6.53147 Sequence: TACTGTATATATAAACAGTA
Locus tag: MELB17_15581
Name: imuA Funciton: Predicted RecA/RadA recombinase
Locus tag: MELB17_15586
Name: imuB Funciton: DNA polymerase-like protein PA0670
Locus tag: MELB17_15591
Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7) |
||||
| imuA-imuB-dnaE2 | -35 | 6.5 | TACTGTATATATAAACAGTA | MELB17_15581 |
| Oceanobacter sp. RED65 | ||||
|
Position: -38
Score: 6.58301 Sequence: TACTGTATATATATACAGTA
Locus tag: RED65_01690
Name: imuA Funciton: Predicted RecA/RadA recombinase
Locus tag: RED65_01685
Name: imuB Funciton: DNA polymerase-like protein PA0670
Locus tag: RED65_01680
Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7) |
||||
| imuA-imuB-dnaE2 | -38 | 6.6 | TACTGTATATATATACAGTA | RED65_01690 |
| Reinekea sp. MED297 | ||||
|
Position: -35
Score: 6.33719 Sequence: TACTGTATATACATACAGTT
Locus tag: MED297_04849
Name: imuA Funciton: Predicted RecA/RadA recombinase
Locus tag: MED297_04854
Name: imuB Funciton: DNA polymerase-like protein PA0670
Locus tag: MED297_04859
Name: dnaE2 Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7) |
||||
| imuA-imuB-dnaE2 | -35 | 6.3 | TACTGTATATACATACAGTT | MED297_04849 |
| Saccharophagus degradans 2-40 | ||||
|
Position: -38
Score: 5.69906 Sequence: TACTGTATAGACATACAGCA
Locus tag: Sde_1030
Name: imuA Funciton: Predicted RecA/RadA recombinase
Locus tag: Sde_1029
Name: imuB Funciton: DNA polymerase-like protein PA0670 |
||||
| imuA-imuB | -38 | 5.7 | TACTGTATAGACATACAGCA | Sde_1030 |
| Teredinibacter turnerae T7901 | ||||
|
Position: -37
Score: 6.16717 Sequence: TACTGTATATTAATACAGTT
Locus tag: TERTU_2925
Name: imuA Funciton: Predicted RecA/RadA recombinase
Locus tag: TERTU_2926
Name: imuB Funciton: DNA polymerase-like protein PA0670 |
||||
| imuA-imuB | -37 | 6.2 | TACTGTATATTAATACAGTT | TERTU_2925 |