Orthologous regulated operons containing recA gene
| Regulog: | LexA - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Alcanivorax borkumensis SK2 | ||||
|
Position: -109
Score: 4.34463 Sequence: TACTGTCCATAACGCCAGTG
Locus tag: ABO_1801
Name: recA Funciton: Recombinase A
Locus tag: ABO_1800
Name: recX Funciton: Regulatory protein RecX |
||||
| recA-recX | -109 | 4.3 | TACTGTCCATAACGCCAGTG | ABO_1801 |
| Cellvibrio japonicus Ueda107 | ||||
|
Position: -126
Score: 5.1653 Sequence: CACTGTATAAATTACTAGTA
Locus tag: CJA_2230
Name: recA Funciton: Recombinase A
Locus tag: CJA_2228
Name: recX Funciton: Regulatory protein RecX |
||||
| recA-recX | -126 | 5.2 | CACTGTATAAATTACTAGTA | CJA_2230 |
| Chromohalobacter salexigens DSM 3043 | ||||
|
Position: -90
Score: 4.95888 Sequence: TACTGGCTAGTCATACAGTA
Locus tag: Csal_0623
Name: recA Funciton: Recombinase A
Locus tag: Csal_0624
Name: recX Funciton: Regulatory protein RecX |
||||
| recA-recX | -90 | 5 | TACTGGCTAGTCATACAGTA | Csal_0623 |
| Hahella chejuensis KCTC 2396 | ||||
|
Position: -76
Score: 5.18281 Sequence: TGCTGTCAATTTATACAGTA
Locus tag: HCH_05232
Name: recA Funciton: Recombinase A |
||||
| recA | -76 | 5.2 | TGCTGTCAATTTATACAGTA | HCH_05232 |
| Marinobacter aqueolei | ||||
|
Position: -108
Score: 5.74382 Sequence: TACTGTTCAAATATACAGGA
Locus tag: Maqu_2082
Name: recA Funciton: Recombinase A |
||||
| recA | -108 | 5.7 | TACTGTTCAAATATACAGGA | Maqu_2082 |
| Marinobacter sp. ELB17 | ||||
|
Position: -142
Score: 5.25952 Sequence: TGCTGGTTAAATATACAGTG
Locus tag: MELB17_08004
Name: recA Funciton: Recombinase A |
||||
| recA | -142 | 5.3 | TGCTGGTTAAATATACAGTG | MELB17_08004 |
| Marinomonas sp. MWYL1 | ||||
|
Position: -87
Score: 5.95242 Sequence: TACTGTTTTTATATACAGTA
Locus tag: Mmwyl1_3732
Name: recA Funciton: Recombinase A |
||||
| recA | -87 | 6 | TACTGTTTTTATATACAGTA | Mmwyl1_3732 |
| Oceanobacter sp. RED65 | ||||
|
Position: -102
Score: 5.32111 Sequence: TACTGGTTAAATTTACAGTG
Locus tag: RED65_07869
Name: recA Funciton: Recombinase A |
||||
| recA | -102 | 5.3 | TACTGGTTAAATTTACAGTG | RED65_07869 |
| Oceanospirillum sp. MED92 | ||||
|
Position: -61
Score: 5.70033 Sequence: TACTGTCCATACATACAGTA
Locus tag: MED92_08116
Name: recA Funciton: Recombinase A
Locus tag: MED92_08121
Name: recX Funciton: Regulatory protein RecX |
||||
| recA-recX | -61 | 5.7 | TACTGTCCATACATACAGTA | MED92_08116 |
| Reinekea sp. MED297 | ||||
|
Position: -31
Score: 4.98751 Sequence: TACTGGTCATTCATACAGCA
Locus tag: MED297_13572
Name: recA Funciton: Recombinase A
Locus tag: MED297_13577
Name: recX Funciton: Regulatory protein RecX |
||||
| recA-recX | -31 | 5 | TACTGGTCATTCATACAGCA | MED297_13572 |
| Saccharophagus degradans 2-40 | ||||
|
Position: -163
Score: 5.17812 Sequence: TACTGTATAAAAAACTATTA
Locus tag: Sde_1288
Name: recA Funciton: Recombinase A
Locus tag: Sde_1289
Name: recX Funciton: Regulatory protein RecX |
||||
| recA-recX | -163 | 5.2 | TACTGTATAAAAAACTATTA | Sde_1288 |
| Teredinibacter turnerae T7901 | ||||
|
Position: -242
Score: 5.3243 Sequence: CACTGTTTACACGTACAGTA
Locus tag: TERTU_2823
Name: recA Funciton: Recombinase A |
||||
| recA | -242 | 5.3 | CACTGTTTACACGTACAGTA | TERTU_2823 |