Orthologous regulated operons containing dps gene
| Regulog: | Irr - Rhodobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Iron homeostasis |
| Effector: | Heme |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Jannaschia sp. CCS1 | ||||
|
Position: -123
Score: 6.27915 Sequence: AGTTTAGAATTATTCTAGACA
Locus tag: Jann_3276
Name: dps Funciton: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1) |
||||
| dps | -123 | 6.3 | AGTTTAGAATTATTCTAGACA | Jann_3276 |
| Sulfitobacter sp. EE-36 | ||||
|
Position: -116
Score: 6.25788 Sequence: AGTTTAGAATAATTCCAAAAA
Locus tag: EE36_01790
Name: dps Funciton: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1) |
||||
| dps | -116 | 6.3 | AGTTTAGAATAATTCCAAAAA | EE36_01790 |