Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing OG2516_18780 gene

Properties
Regulog: Irr - Rhodobacterales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Heme
Phylum: Proteobacteria/alpha
Built upon 37 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Roseovarius sp. 217
Position: -100
Score: 5.96286
Sequence: ACCTTAGAACTGTTCTAAATT
Locus tag: ROS217_20542
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: ROS217_20537
Name: sufS
Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: ROS217_20532
Name: sufB
Funciton: Iron-sulfur assembly protein SufB
Locus tag: ROS217_20527
Name: PF01906
Funciton: hypothetical protein
Locus tag: ROS217_20522
Name: null
Funciton: hypothetical protein
Locus tag: ROS217_20517
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: ROS217_20512
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: ROS217_20507
Name: PF04893
Funciton: hypothetical protein
Locus tag: ROS217_20502
Name: PF04893
Funciton: hypothetical protein
Locus tag: ROS217_20497
Name: sufS2
Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
iscR-sufS-sufB-PF01906-ROS217_20522-sufC-sufD-PF04893-PF04893-sufS2 -100 6 ACCTTAGAACTGTTCTAAATT ROS217_20542
© 2009-2020 RegPrecise