Orthologous regulated operons containing OG2516_18780 gene
| Regulog: | Irr - Rhodobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Iron homeostasis |
| Effector: | Heme |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Roseovarius sp. 217 | ||||
|
Position: -100
Score: 5.96286 Sequence: ACCTTAGAACTGTTCTAAATT
Locus tag: ROS217_20542
Name: iscR Funciton: Iron-sulfur cluster regulator IscR
Locus tag: ROS217_20537
Name: sufS Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: ROS217_20532
Name: sufB Funciton: Iron-sulfur assembly protein SufB
Locus tag: ROS217_20527
Name: PF01906 Funciton: hypothetical protein
Locus tag: ROS217_20522
Name: null Funciton: hypothetical protein
Locus tag: ROS217_20517
Name: sufC Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: ROS217_20512
Name: sufD Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: ROS217_20507
Name: PF04893 Funciton: hypothetical protein
Locus tag: ROS217_20502
Name: PF04893 Funciton: hypothetical protein
Locus tag: ROS217_20497
Name: sufS2 Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
||||
| iscR-sufS-sufB-PF01906-ROS217_20522-sufC-sufD-PF04893-PF04893-sufS2 | -100 | 6 | ACCTTAGAACTGTTCTAAATT | ROS217_20542 |