Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing ISM_16000 gene

Properties
Regulog: Irr - Rhodobacterales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Heme
Phylum: Proteobacteria/alpha
Built upon 37 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Roseovarius nubinhibens ISM
Position: -129
Score: 6.34207
Sequence: ACTTTAGAACTGTTCTAAACA
Locus tag: ISM_16015
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: ISM_16010
Name: sufS
Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: ISM_16005
Name: sufB
Funciton: Iron-sulfur assembly protein SufB
Locus tag: ISM_16000
Name: null
Funciton: hypothetical protein
Locus tag: ISM_15995
Name: PF02475
Funciton: Methyltransferase FkbM
Locus tag: ISM_15990
Name: null
Funciton: hypothetical protein
Locus tag: ISM_15985
Name: PF02475
Funciton: Protein of unknown function Met10
Locus tag: ISM_15980
Name: PDB:3cvoA
Funciton: hypothetical protein
Locus tag: ISM_15975
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: ISM_15970
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: ISM_15965
Name: PF04893
Funciton: hypothetical protein
Locus tag: ISM_15960
Name: PF04893
Funciton: hypothetical protein
Locus tag: ISM_15955
Name: sufS2
Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
iscR-sufS-sufB-ISM_16000-PF02475-ISM_15990-PF02475-PDB:3cvoA-sufC-sufD-PF04893-PF04893-sufS2 -129 6.3 ACTTTAGAACTGTTCTAAACA ISM_16015
© 2009-2020 RegPrecise