Orthologous regulated operons containing ISM_16000 gene
| Regulog: | Irr - Rhodobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Iron homeostasis |
| Effector: | Heme |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Roseovarius nubinhibens ISM | ||||
|
Position: -129
Score: 6.34207 Sequence: ACTTTAGAACTGTTCTAAACA
Locus tag: ISM_16015
Name: iscR Funciton: Iron-sulfur cluster regulator IscR
Locus tag: ISM_16010
Name: sufS Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: ISM_16005
Name: sufB Funciton: Iron-sulfur assembly protein SufB
Locus tag: ISM_16000
Name: null Funciton: hypothetical protein
Locus tag: ISM_15995
Name: PF02475 Funciton: Methyltransferase FkbM
Locus tag: ISM_15990
Name: null Funciton: hypothetical protein
Locus tag: ISM_15985
Name: PF02475 Funciton: Protein of unknown function Met10
Locus tag: ISM_15980
Name: PDB:3cvoA Funciton: hypothetical protein
Locus tag: ISM_15975
Name: sufC Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: ISM_15970
Name: sufD Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: ISM_15965
Name: PF04893 Funciton: hypothetical protein
Locus tag: ISM_15960
Name: PF04893 Funciton: hypothetical protein
Locus tag: ISM_15955
Name: sufS2 Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
||||
| iscR-sufS-sufB-ISM_16000-PF02475-ISM_15990-PF02475-PDB:3cvoA-sufC-sufD-PF04893-PF04893-sufS2 | -129 | 6.3 | ACTTTAGAACTGTTCTAAACA | ISM_16015 |