Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing EE36_14317 gene

Properties
Regulog: Irr - Rhodobacterales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Heme
Phylum: Proteobacteria/alpha
Built upon 37 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Sulfitobacter sp. EE-36
Position: -116
Score: 5.90335
Sequence: AGTTTAGAACGGTTCTAACTT
Locus tag: EE36_14302
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: EE36_14307
Name: sufS
Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: EE36_14312
Name: sufB
Funciton: Iron-sulfur assembly protein SufB
Locus tag: EE36_14317
Name: null
Funciton: hypothetical protein
Locus tag: EE36_14322
Name: PF04230
Funciton: ExoV domain protein
Locus tag: EE36_14327
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: EE36_14332
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: EE36_14337
Name: PF04893
Funciton: hypothetical protein
Locus tag: EE36_14342
Name: PF04893
Funciton: hypothetical protein
Locus tag: EE36_14347
Name: sufS2
Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
iscR-sufS-sufB-EE36_14317-PF04230-sufC-sufD-PF04893-PF04893-sufS2 -116 5.9 AGTTTAGAACGGTTCTAACTT EE36_14302