Orthologous regulated operons containing PF04230 gene

Properties
Regulog:	Irr - Rhodobacterales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Heme
Phylum:	Proteobacteria/alpha

Built upon 37 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Jannaschia sp. CCS1
Position: -137 Score: 5.18857 Sequence: ACCCTAGAACGATTCCAAATT Locus tag: Jann_2366 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Jann_2365 Name: sufS Funciton: Cysteine desulfurase (EC 2.8.1.7) Locus tag: Jann_2364 Name: sufB Funciton: Iron-sulfur assembly protein SufB Locus tag: Jann_2363 Name: TIGR01444 Funciton: Methyltransferase FkbM Locus tag: Jann_2362 Name: PF02475 Funciton: Methyltransferase FkbM Locus tag: Jann_2361 Name: PF04230 Funciton: ExoV domain protein Locus tag: Jann_2360 Name: PF02475 Funciton: Methyltransferase FkbM Locus tag: Jann_2359 Name: sufC Funciton: Iron-sulfur cluster assembly ATPase protein SufC Locus tag: Jann_2358 Name: sufD Funciton: Iron-sulfur cluster assembly protein SufD Locus tag: Jann_2357 Name: PF04893 Funciton: hypothetical protein Locus tag: Jann_2356 Name: PF04893 Funciton: hypothetical protein Locus tag: Jann_2355 Name: sufS2 Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
iscR-sufS-sufB-TIGR01444-PF02475-PF04230-PF02475-sufC-sufD-PF04893-PF04893-sufS2	-137	5.2	ACCCTAGAACGATTCCAAATT	Jann_2366
Roseobacter sp. MED193
Position: -124 Score: 5.31165 Sequence: ATCTTAGAACAATTCTAATTG Locus tag: MED193_04321 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: MED193_04316 Name: sufS Funciton: Cysteine desulfurase (EC 2.8.1.7) Locus tag: MED193_04311 Name: sufB Funciton: Iron-sulfur assembly protein SufB Locus tag: MED193_04306 Name: null Funciton: hypothetical protein Locus tag: MED193_04301 Name: PF01906 Funciton: hypothetical protein Locus tag: MED193_04296 Name: PF04230 Funciton: ExoV domain protein Locus tag: MED193_04291 Name: sufC Funciton: Iron-sulfur cluster assembly ATPase protein SufC Locus tag: MED193_04286 Name: sufD Funciton: Iron-sulfur cluster assembly protein SufD Locus tag: MED193_04281 Name: PF04893 Funciton: hypothetical protein Locus tag: MED193_04276 Name: PF04893 Funciton: hypothetical protein Locus tag: MED193_04271 Name: sufS2 Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
iscR-sufS-sufB-MED193_04306-PF01906-PF04230-sufC-sufD-PF04893-PF04893-sufS2	-124	5.3	ATCTTAGAACAATTCTAATTG	MED193_04321
Sulfitobacter sp. EE-36
Position: -116 Score: 5.90335 Sequence: AGTTTAGAACGGTTCTAACTT Locus tag: EE36_14302 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: EE36_14307 Name: sufS Funciton: Cysteine desulfurase (EC 2.8.1.7) Locus tag: EE36_14312 Name: sufB Funciton: Iron-sulfur assembly protein SufB Locus tag: EE36_14317 Name: null Funciton: hypothetical protein Locus tag: EE36_14322 Name: PF04230 Funciton: ExoV domain protein Locus tag: EE36_14327 Name: sufC Funciton: Iron-sulfur cluster assembly ATPase protein SufC Locus tag: EE36_14332 Name: sufD Funciton: Iron-sulfur cluster assembly protein SufD Locus tag: EE36_14337 Name: PF04893 Funciton: hypothetical protein Locus tag: EE36_14342 Name: PF04893 Funciton: hypothetical protein Locus tag: EE36_14347 Name: sufS2 Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
iscR-sufS-sufB-EE36_14317-PF04230-sufC-sufD-PF04893-PF04893-sufS2	-116	5.9	AGTTTAGAACGGTTCTAACTT	EE36_14302