Orthologous regulated operons containing MED193_04306 gene
| Regulog: | Irr - Rhodobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Iron homeostasis |
| Effector: | Heme |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Roseobacter sp. MED193 | ||||
|
Position: -124
Score: 5.31165 Sequence: ATCTTAGAACAATTCTAATTG
Locus tag: MED193_04321
Name: iscR Funciton: Iron-sulfur cluster regulator IscR
Locus tag: MED193_04316
Name: sufS Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: MED193_04311
Name: sufB Funciton: Iron-sulfur assembly protein SufB
Locus tag: MED193_04306
Name: null Funciton: hypothetical protein
Locus tag: MED193_04301
Name: PF01906 Funciton: hypothetical protein
Locus tag: MED193_04296
Name: PF04230 Funciton: ExoV domain protein
Locus tag: MED193_04291
Name: sufC Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: MED193_04286
Name: sufD Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: MED193_04281
Name: PF04893 Funciton: hypothetical protein
Locus tag: MED193_04276
Name: PF04893 Funciton: hypothetical protein
Locus tag: MED193_04271
Name: sufS2 Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
||||
| iscR-sufS-sufB-MED193_04306-PF01906-PF04230-sufC-sufD-PF04893-PF04893-sufS2 | -124 | 5.3 | ATCTTAGAACAATTCTAATTG | MED193_04321 |