Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing MED193_04306 gene

Properties
Regulog: Irr - Rhodobacterales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Heme
Phylum: Proteobacteria/alpha
Built upon 37 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Roseobacter sp. MED193
Position: -124
Score: 5.31165
Sequence: ATCTTAGAACAATTCTAATTG
Locus tag: MED193_04321
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: MED193_04316
Name: sufS
Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: MED193_04311
Name: sufB
Funciton: Iron-sulfur assembly protein SufB
Locus tag: MED193_04306
Name: null
Funciton: hypothetical protein
Locus tag: MED193_04301
Name: PF01906
Funciton: hypothetical protein
Locus tag: MED193_04296
Name: PF04230
Funciton: ExoV domain protein
Locus tag: MED193_04291
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: MED193_04286
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: MED193_04281
Name: PF04893
Funciton: hypothetical protein
Locus tag: MED193_04276
Name: PF04893
Funciton: hypothetical protein
Locus tag: MED193_04271
Name: sufS2
Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
iscR-sufS-sufB-MED193_04306-PF01906-PF04230-sufC-sufD-PF04893-PF04893-sufS2 -124 5.3 ATCTTAGAACAATTCTAATTG MED193_04321
© 2009-2020 RegPrecise