Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing TIGR01444 gene

Properties
Regulog: Irr - Rhodobacterales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Iron homeostasis
Effector: Heme
Phylum: Proteobacteria/alpha
Built upon 37 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Jannaschia sp. CCS1
Position: -137
Score: 5.18857
Sequence: ACCCTAGAACGATTCCAAATT
Locus tag: Jann_2366
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: Jann_2365
Name: sufS
Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: Jann_2364
Name: sufB
Funciton: Iron-sulfur assembly protein SufB
Locus tag: Jann_2363
Name: TIGR01444
Funciton: Methyltransferase FkbM
Locus tag: Jann_2362
Name: PF02475
Funciton: Methyltransferase FkbM
Locus tag: Jann_2361
Name: PF04230
Funciton: ExoV domain protein
Locus tag: Jann_2360
Name: PF02475
Funciton: Methyltransferase FkbM
Locus tag: Jann_2359
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: Jann_2358
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: Jann_2357
Name: PF04893
Funciton: hypothetical protein
Locus tag: Jann_2356
Name: PF04893
Funciton: hypothetical protein
Locus tag: Jann_2355
Name: sufS2
Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
iscR-sufS-sufB-TIGR01444-PF02475-PF04230-PF02475-sufC-sufD-PF04893-PF04893-sufS2 -137 5.2 ACCCTAGAACGATTCCAAATT Jann_2366
© 2009-2020 RegPrecise