Orthologous regulated operons containing PDB:3cvoA gene

Properties
Regulog:	Irr - Rhodobacterales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Iron homeostasis
Effector:	Heme
Phylum:	Proteobacteria/alpha

Built upon 37 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Oceanicola batsensis HTCC2597
Position: -114 Score: 5.03496 Sequence: ACCTTAGAAAGATTCTAAAGC Locus tag: OB2597_03589 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: OB2597_03584 Name: sufS Funciton: Cysteine desulfurase (EC 2.8.1.7) Locus tag: OB2597_03579 Name: sufB Funciton: Iron-sulfur assembly protein SufB Locus tag: OB2597_03574 Name: PF01906 Funciton: hypothetical protein Locus tag: OB2597_03569 Name: PDB:3cvoA Funciton: hypothetical protein Locus tag: OB2597_03564 Name: sufC Funciton: Iron-sulfur cluster assembly ATPase protein SufC Locus tag: OB2597_03559 Name: sufD Funciton: Iron-sulfur cluster assembly protein SufD Locus tag: OB2597_03554 Name: PF04893 Funciton: hypothetical protein Locus tag: OB2597_03549 Name: PF04893 Funciton: hypothetical protein Locus tag: OB2597_03544 Name: sufS2 Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
iscR-sufS-sufB-PF01906-PDB:3cvoA-sufC-sufD-PF04893-PF04893-sufS2	-114	5	ACCTTAGAAAGATTCTAAAGC	OB2597_03589
Oceanicola granulosus HTCC2516
Position: -131 Score: 6.318 Sequence: TGTTTAGAAGTGTTCTAAACT Locus tag: OG2516_03700 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: OG2516_03695 Name: sufS Funciton: Cysteine desulfurase (EC 2.8.1.7) Locus tag: OG2516_03690 Name: sufB Funciton: Iron-sulfur assembly protein SufB Locus tag: OG2516_03685 Name: PF02475 Funciton: Methyltransferase FkbM Locus tag: OG2516_03680 Name: PDB:3cvoA Funciton: hypothetical protein Locus tag: OG2516_03675 Name: sufC Funciton: Iron-sulfur cluster assembly ATPase protein SufC Locus tag: OG2516_03670 Name: sufD Funciton: Iron-sulfur cluster assembly protein SufD Locus tag: OG2516_03665 Name: PF04893 Funciton: hypothetical protein Locus tag: OG2516_03660 Name: PF04893 Funciton: hypothetical protein Locus tag: OG2516_03655 Name: sufS2 Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
iscR-sufS-sufB-PF02475-PDB:3cvoA-sufC-sufD-PF04893-PF04893-sufS2	-131	6.3	TGTTTAGAAGTGTTCTAAACT	OG2516_03700
Roseovarius nubinhibens ISM
Position: -129 Score: 6.34207 Sequence: ACTTTAGAACTGTTCTAAACA Locus tag: ISM_16015 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: ISM_16010 Name: sufS Funciton: Cysteine desulfurase (EC 2.8.1.7) Locus tag: ISM_16005 Name: sufB Funciton: Iron-sulfur assembly protein SufB Locus tag: ISM_16000 Name: null Funciton: hypothetical protein Locus tag: ISM_15995 Name: PF02475 Funciton: Methyltransferase FkbM Locus tag: ISM_15990 Name: null Funciton: hypothetical protein Locus tag: ISM_15985 Name: PF02475 Funciton: Protein of unknown function Met10 Locus tag: ISM_15980 Name: PDB:3cvoA Funciton: hypothetical protein Locus tag: ISM_15975 Name: sufC Funciton: Iron-sulfur cluster assembly ATPase protein SufC Locus tag: ISM_15970 Name: sufD Funciton: Iron-sulfur cluster assembly protein SufD Locus tag: ISM_15965 Name: PF04893 Funciton: hypothetical protein Locus tag: ISM_15960 Name: PF04893 Funciton: hypothetical protein Locus tag: ISM_15955 Name: sufS2 Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
iscR-sufS-sufB-ISM_16000-PF02475-ISM_15990-PF02475-PDB:3cvoA-sufC-sufD-PF04893-PF04893-sufS2	-129	6.3	ACTTTAGAACTGTTCTAAACA	ISM_16015