Orthologous regulated operons containing PF01906 gene
| Regulog: | Irr - Rhodobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Iron homeostasis |
| Effector: | Heme |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Oceanicola batsensis HTCC2597 | ||||
|
Position: -114
Score: 5.03496 Sequence: ACCTTAGAAAGATTCTAAAGC
Locus tag: OB2597_03589
Name: iscR Funciton: Iron-sulfur cluster regulator IscR
Locus tag: OB2597_03584
Name: sufS Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: OB2597_03579
Name: sufB Funciton: Iron-sulfur assembly protein SufB
Locus tag: OB2597_03574
Name: PF01906 Funciton: hypothetical protein
Locus tag: OB2597_03569
Name: PDB:3cvoA Funciton: hypothetical protein
Locus tag: OB2597_03564
Name: sufC Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: OB2597_03559
Name: sufD Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: OB2597_03554
Name: PF04893 Funciton: hypothetical protein
Locus tag: OB2597_03549
Name: PF04893 Funciton: hypothetical protein
Locus tag: OB2597_03544
Name: sufS2 Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
||||
| iscR-sufS-sufB-PF01906-PDB:3cvoA-sufC-sufD-PF04893-PF04893-sufS2 | -114 | 5 | ACCTTAGAAAGATTCTAAAGC | OB2597_03589 |
| Roseobacter sp. MED193 | ||||
|
Position: -124
Score: 5.31165 Sequence: ATCTTAGAACAATTCTAATTG
Locus tag: MED193_04321
Name: iscR Funciton: Iron-sulfur cluster regulator IscR
Locus tag: MED193_04316
Name: sufS Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: MED193_04311
Name: sufB Funciton: Iron-sulfur assembly protein SufB
Locus tag: MED193_04306
Name: null Funciton: hypothetical protein
Locus tag: MED193_04301
Name: PF01906 Funciton: hypothetical protein
Locus tag: MED193_04296
Name: PF04230 Funciton: ExoV domain protein
Locus tag: MED193_04291
Name: sufC Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: MED193_04286
Name: sufD Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: MED193_04281
Name: PF04893 Funciton: hypothetical protein
Locus tag: MED193_04276
Name: PF04893 Funciton: hypothetical protein
Locus tag: MED193_04271
Name: sufS2 Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
||||
| iscR-sufS-sufB-MED193_04306-PF01906-PF04230-sufC-sufD-PF04893-PF04893-sufS2 | -124 | 5.3 | ATCTTAGAACAATTCTAATTG | MED193_04321 |
| Roseovarius sp. 217 | ||||
|
Position: -100
Score: 5.96286 Sequence: ACCTTAGAACTGTTCTAAATT
Locus tag: ROS217_20542
Name: iscR Funciton: Iron-sulfur cluster regulator IscR
Locus tag: ROS217_20537
Name: sufS Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: ROS217_20532
Name: sufB Funciton: Iron-sulfur assembly protein SufB
Locus tag: ROS217_20527
Name: PF01906 Funciton: hypothetical protein
Locus tag: ROS217_20522
Name: null Funciton: hypothetical protein
Locus tag: ROS217_20517
Name: sufC Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: ROS217_20512
Name: sufD Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: ROS217_20507
Name: PF04893 Funciton: hypothetical protein
Locus tag: ROS217_20502
Name: PF04893 Funciton: hypothetical protein
Locus tag: ROS217_20497
Name: sufS2 Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
||||
| iscR-sufS-sufB-PF01906-ROS217_20522-sufC-sufD-PF04893-PF04893-sufS2 | -100 | 6 | ACCTTAGAACTGTTCTAAATT | ROS217_20542 |
| Silicibacter TM1040 | ||||
|
Position: -117
Score: 5.69427 Sequence: ACCTTAGAACTGTTCTAAAGA
Locus tag: TM1040_1240
Name: iscR Funciton: Iron-sulfur cluster regulator IscR
Locus tag: TM1040_1241
Name: sufS Funciton: Cysteine desulfurase (EC 2.8.1.7)
Locus tag: TM1040_1242
Name: sufB Funciton: Iron-sulfur assembly protein SufB
Locus tag: TM1040_1243
Name: PF01906 Funciton: hypothetical protein
Locus tag: TM1040_1244
Name: PF02475 Funciton: Methyltransferase FkbM
Locus tag: TM1040_1245
Name: sufC Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: TM1040_1246
Name: sufD Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: TM1040_1247
Name: PF04893 Funciton: hypothetical protein
Locus tag: TM1040_1248
Name: PF04893 Funciton: hypothetical protein
Locus tag: TM1040_1249
Name: sufS2 Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily |
||||
| iscR-sufS-sufB-PF01906-PF02475-sufC-sufD-PF04893-PF04893-sufS2 | -117 | 5.7 | ACCTTAGAACTGTTCTAAAGA | TM1040_1240 |