Orthologous regulated operons containing radA gene
| Regulog: | LexA - Psychromonadaceae/Aeromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Moritella sp. PE36 | ||||
|
Position: -65
Score: 5.4325 Sequence: AACTGTATATACATCCAGAT
Locus tag: PE36_11322
Name: radA Funciton: DNA repair protein RadA |
||||
| radA | -65 | 5.4 | AACTGTATATACATCCAGAT | PE36_11322 |
| Psychromonas sp. CNPT3 | ||||
|
Position: -43
Score: 5.57814 Sequence: TACTGTTCATAATAACAGTA
Locus tag: PCNPT3_07113
Name: null Funciton: Regulatory protein RecX
Locus tag: PCNPT3_07108
Name: radA Funciton: DNA repair protein RadA |
||||
| PCNPT3_07113-radA | -43 | 5.6 | TACTGTTCATAATAACAGTA | PCNPT3_07113 |