Orthologous regulated operons containing recA gene
| Regulog: | LexA - Pasteurellales |
| Regulator type: | Transcription factor |
| Regulator family: | LexA |
| Regulation mode: | repressor |
| Biological process: | SOS response |
| Effector: | DNA damage |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Actinobacillus pleuropneumoniae serovar 7 str. AP76 | ||||
|
Position: -86
Score: 5.30369 Sequence: AACTGTATAAGTAAACACTA
Locus tag: APP7_1202
Name: recA Funciton: Recombinase A
Locus tag: APP7_1201
Name: recX Funciton: Regulatory protein RecX |
||||
| recA-recX | -86 | 5.3 | AACTGTATAAGTAAACACTA | APP7_1202 |
| Actinobacillus succinogenes 130Z | ||||
|
Position: -63
Score: 5.18491 Sequence: TACTGTGTTTTATACCAGTT
Locus tag: Asuc_0261
Name: recA Funciton: Recombinase A
Locus tag: Asuc_0260
Name: recX Funciton: Regulatory protein RecX |
||||
| recA-recX | -63 | 5.2 | TACTGTGTTTTATACCAGTT | Asuc_0261 |
| Aggregatibacter aphrophilus NJ8700 | ||||
|
Position: -67
Score: 6.07336 Sequence: TACTGTATATTAATACAGTT
Locus tag: NT05HA_1941
Name: recA Funciton: Recombinase A
Locus tag: NT05HA_1940
Name: recX Funciton: Regulatory protein RecX |
||||
| recA-recX | -67 | 6.1 | TACTGTATATTAATACAGTT | NT05HA_1941 |
| Haemophilus ducreyi 35000HP | ||||
|
Position: -84
Score: 5.30369 Sequence: AACTGTATAAGTAAACACTA
Locus tag: HD0410
Name: recA Funciton: Recombinase A
Locus tag: HD0411
Name: recX Funciton: Regulatory protein RecX |
||||
| recA-recX | -84 | 5.3 | AACTGTATAAGTAAACACTA | HD0410 |
| Haemophilus influenzae Rd KW20 | ||||
|
Position: -60
Score: 5.12711 Sequence: ACCTGTACATCAATACAGAT
Locus tag: HI0600
Name: recA Funciton: Recombinase A
Locus tag: HI0599
Name: recX Funciton: Regulatory protein RecX |
||||
| recA-recX | -60 | 5.1 | ACCTGTACATCAATACAGAT | HI0600 |
| Haemophilus parasuis SH0165 | ||||
|
Position: -84
Score: 5.26607 Sequence: AACTGTATGGTTAAACAGTA
Locus tag: HAPS_1186
Name: recA Funciton: Recombinase A
Locus tag: HAPS_1185
Name: recX Funciton: Regulatory protein RecX |
||||
| recA-recX | -84 | 5.3 | AACTGTATGGTTAAACAGTA | HAPS_1186 |
| Haemophilus somnus 2336 | ||||
|
Position: -66
Score: 5.20804 Sequence: CACTGTATGTGAATACAGTA
Locus tag: HSM_0315
Name: recA Funciton: Recombinase A
Locus tag: HSM_0314
Name: recX Funciton: Regulatory protein RecX |
||||
| recA-recX | -66 | 5.2 | CACTGTATGTGAATACAGTA | HSM_0315 |
| Mannheimia succiniciproducens MBEL55E | ||||
|
Position: -69
Score: 5.76786 Sequence: TACTGTATATTATACCAGTT
Locus tag: MS2243
Name: recA Funciton: Recombinase A
Locus tag: MS2242
Name: recX Funciton: Regulatory protein RecX |
||||
| recA-recX | -69 | 5.8 | TACTGTATATTATACCAGTT | MS2243 |
| Pasteurella multocida subsp. multocida str. Pm70 | ||||
|
Position: -66
Score: 5.55974 Sequence: TACTGTTTATTCATACAGTT
Locus tag: PM1817
Name: recA Funciton: Recombinase A
Locus tag: PM1816
Name: recX Funciton: Regulatory protein RecX |
||||
| recA-recX | -66 | 5.6 | TACTGTTTATTCATACAGTT | PM1817 |