Orthologous regulated operons containing SO3621 gene
| Regulog: | SO3627 - Shewanellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Shewanella oneidensis MR-1 | ||||
|
Position: -1477
Score: 6.93397 Sequence: TTCTTGAGaTACAaCTCAAAAA
Locus tag: SO_3624
Name: SO3624 Funciton: Flavocytochrome c flavin subunit
Locus tag: SO_3623
Name: null Funciton: Flavocytochrome c heme subunit
Locus tag: SO_3622
Name: SO3622 Funciton: conserved domain protein
Locus tag: SO_3621
Name: SO3621 Funciton: conserved hypothetical protein lipoprotein |
||||
| SO3624-SO_3623-SO3622-SO3621 | -1477 | 6.9 | TTCTTGAGaTACAaCTCAAAAA | SO_3624 |
| Shewanella sediminis HAW-EB3 | ||||
|
Position: -113
Score: 6.97508 Sequence: TTCTTGAGGTACACCACAAAAA
Locus tag: Ssed_4178
Name: SO3624 Funciton: Flavocytochrome c flavin subunit
Locus tag: Ssed_4179
Name: null Funciton: Flavocytochrome c heme subunit
Locus tag: Ssed_4180
Name: SO3622 Funciton: conserved domain protein
Locus tag: Ssed_4181
Name: SO3621 Funciton: conserved hypothetical protein lipoprotein |
||||
| SO3624-Ssed_4179-SO3622-SO3621 | -113 | 7 | TTCTTGAGGTACACCACAAAAA | Ssed_4178 |