Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing SO3621 gene

Properties
Regulog: SO3627 - Shewanellaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process:
Effector:
Phylum: Proteobacteria/gamma
Built upon 4 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella oneidensis MR-1
Position: -1477
Score: 6.93397
Sequence: TTCTTGAGaTACAaCTCAAAAA
Locus tag: SO_3624
Name: SO3624
Funciton: Flavocytochrome c flavin subunit
Locus tag: SO_3623
Name: null
Funciton: Flavocytochrome c heme subunit
Locus tag: SO_3622
Name: SO3622
Funciton: conserved domain protein
Locus tag: SO_3621
Name: SO3621
Funciton: conserved hypothetical protein lipoprotein
SO3624-SO_3623-SO3622-SO3621 -1477 6.9 TTCTTGAGaTACAaCTCAAAAA SO_3624
Shewanella sediminis HAW-EB3
Position: -113
Score: 6.97508
Sequence: TTCTTGAGGTACACCACAAAAA
Locus tag: Ssed_4178
Name: SO3624
Funciton: Flavocytochrome c flavin subunit
Locus tag: Ssed_4179
Name: null
Funciton: Flavocytochrome c heme subunit
Locus tag: Ssed_4180
Name: SO3622
Funciton: conserved domain protein
Locus tag: Ssed_4181
Name: SO3621
Funciton: conserved hypothetical protein lipoprotein
SO3624-Ssed_4179-SO3622-SO3621 -113 7 TTCTTGAGGTACACCACAAAAA Ssed_4178
© 2009-2020 RegPrecise