Orthologous regulated operons containing mexE gene

Properties
Regulog:	SO3494 - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Multidrug resistance
Effector:
Phylum:	Proteobacteria/gamma

Built upon 31 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella baltica OS155
Position: -145 Score: 6.19802 Sequence: TTAATACCAATCGGTACATA Position: -72 Score: 5.99244 Sequence: TTTTTACCAGTCGGTATTTA Locus tag: Sbal_3182 Name: mexE Funciton: RND multidrug efflux membrane fusion protein MexE Locus tag: Sbal_3181 Name: mexF Funciton: Acriflavin resistance protein
mexE-mexF	-145	6.2	TTAATACCAATCGGTACATA	Sbal_3182
	-72	6	TTTTTACCAGTCGGTATTTA
Shewanella denitrificans OS217
Position: -119 Score: 5.80998 Sequence: AAATTACCAATCGGTACAAA Position: -70 Score: 5.23755 Sequence: ATCATACCGACCGGTACAAA Locus tag: Sden_3079 Name: mexE Funciton: RND multidrug efflux membrane fusion protein MexE Locus tag: Sden_3080 Name: mexF Funciton: Acriflavin resistance protein
mexE-mexF	-119	5.8	AAATTACCAATCGGTACAAA	Sden_3079
	-70	5.2	ATCATACCGACCGGTACAAA
Shewanella frigidimarina NCIMB 400
Position: -169 Score: 6.25193 Sequence: TTAATACCAATCGGTACAAA Position: -97 Score: 6.30585 Sequence: TTTGTACCGATTGGTATAAA Locus tag: Sfri_3985 Name: mexE Funciton: RND multidrug efflux membrane fusion protein MexE Locus tag: Sfri_3986 Name: mexF Funciton: Acriflavin resistance protein
mexE-mexF	-169	6.3	TTAATACCAATCGGTACAAA	Sfri_3985
	-97	6.3	TTTGTACCGATTGGTATAAA
Shewanella oneidensis MR-1
Position: 99 Score: 6.24162 Sequence: TTTtTACCAATCGGTATttA Locus tag: SO_3493 Name: mexE Funciton: RND multidrug efflux membrane fusion protein MexE Locus tag: SO_3492 Name: mexF Funciton: Acriflavin resistance protein
mexE-mexF	99	6.2	TTTtTACCAATCGGTATttA	SO_3493
Shewanella putrefaciens CN-32
Position: -170 Score: 5.94883 Sequence: TTAATACCAGTCGGTACATA Position: -97 Score: 5.99244 Sequence: TTTTTACCAGTCGGTATTTA Locus tag: Sputcn32_2792 Name: mexE Funciton: RND multidrug efflux membrane fusion protein MexE Locus tag: Sputcn32_2791 Name: mexF Funciton: Acriflavin resistance protein
mexE-mexF	-170	5.9	TTAATACCAGTCGGTACATA	Sputcn32_2792
	-97	6	TTTTTACCAGTCGGTATTTA
Shewanella sp ANA-3
Position: -166 Score: 5.20216 Sequence: TAAATACTCATCGGTACAAA Position: -94 Score: 5.99244 Sequence: TTTTTACCAGTCGGTATTTA Locus tag: Shewana3_1077 Name: mexE Funciton: RND multidrug efflux membrane fusion protein MexE Locus tag: Shewana3_1078 Name: mexF Funciton: Acriflavin resistance protein
mexE-mexF	-166	5.2	TAAATACTCATCGGTACAAA	Shewana3_1077
	-94	6	TTTTTACCAGTCGGTATTTA
Shewanella sp MR-4
Position: -166 Score: 5.20216 Sequence: TAAATACTTATCGGTACAAA Position: -93 Score: 5.99244 Sequence: TTTTTACCAGTCGGTATTTA Locus tag: Shewmr4_1073 Name: mexE Funciton: RND multidrug efflux membrane fusion protein MexE Locus tag: Shewmr4_1074 Name: mexF Funciton: Acriflavin resistance protein
mexE-mexF	-166	5.2	TAAATACTTATCGGTACAAA	Shewmr4_1073
	-93	6	TTTTTACCAGTCGGTATTTA
Shewanella sp MR-7
Position: -166 Score: 5.20216 Sequence: TAAATACTTATCGGTACAAA Position: -93 Score: 6.24162 Sequence: TTTTTACCAATCGGTATTTA Locus tag: Shewmr7_1145 Name: mexE Funciton: RND multidrug efflux membrane fusion protein MexE Locus tag: Shewmr7_1146 Name: mexF Funciton: Acriflavin resistance protein
mexE-mexF	-166	5.2	TAAATACTTATCGGTACAAA	Shewmr7_1145
	-93	6.2	TTTTTACCAATCGGTATTTA
Shewanella sp W3-18-1
Position: -170 Score: 5.94883 Sequence: TTAATACCAGTCGGTACATA Position: -97 Score: 5.99244 Sequence: TTTTTACCAGTCGGTATTTA Locus tag: Sputw3181_1220 Name: mexE Funciton: RND multidrug efflux membrane fusion protein MexE Locus tag: Sputw3181_1221 Name: mexF Funciton: Acriflavin resistance protein
mexE-mexF	-170	5.9	TTAATACCAGTCGGTACATA	Sputw3181_1220
	-97	6	TTTTTACCAGTCGGTATTTA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing mexE gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --