Orthologous regulated operons containing Sden_2206 gene
| Regulog: | SO1703 - Shewanellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Multidrug resistance |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Shewanella denitrificans OS217 | ||||
|
Position: -64
Score: 5.74714 Sequence: TATTCATCAGATGGGGAATT
Locus tag: Sden_2204
Name: SO1703 Funciton: Transcriptional regulator, TetR family
Locus tag: Sden_2205
Name: Shew_3566 Funciton: efflux transporter, RND family, MFP subunit
Locus tag: Sden_2206
Name: Sden_2206 Funciton: Acriflavin resistance transporter, membrane protein |
||||
| SO1703-Shew_3566-Sden_2206 | -64 | 5.7 | TATTCATCAGATGGGGAATT | Sden_2204 |
| Shewanella loihica PV-4 | ||||
|
Position: -23
Score: 6.29599 Sequence: AATTCCTCTACTGAGGAATT
Locus tag: Shew_3567
Name: SO1703 Funciton: Transcriptional regulator, TetR family
Locus tag: Shew_3566
Name: Shew_3566 Funciton: efflux transporter, RND family, MFP subunit
Locus tag: Shew_3565
Name: Sden_2206 Funciton: Acriflavin resistance transporter, membrane protein |
||||
| SO1703-Shew_3566-Sden_2206 | -23 | 6.3 | AATTCCTCTACTGAGGAATT | Shew_3567 |
| Shewanella sediminis HAW-EB3 | ||||
|
Position: -24
Score: 5.73009 Sequence: AATTCTTTAACTGAGGAATA
Locus tag: Ssed_2917
Name: SO1703 Funciton: Transcriptional regulator, TetR family
Locus tag: Ssed_2916
Name: Shew_3566 Funciton: efflux transporter, RND family, MFP subunit
Locus tag: Ssed_2915
Name: Sden_2206 Funciton: Acriflavin resistance transporter, membrane protein |
||||
| SO1703-Shew_3566-Sden_2206 | -24 | 5.7 | AATTCTTTAACTGAGGAATA | Ssed_2917 |