Orthologous regulated operons containing SO1707 gene

Properties
Regulog:	SO1703 - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Multidrug resistance
Effector:
Phylum:	Proteobacteria/gamma

Built upon 11 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella amazonensis SB2B
Position: -33 Score: 5.75835 Sequence: TGTTCATCAAGAGAGGAATT Locus tag: Sama_3590 Name: SO1703 Funciton: Transcriptional regulator, TetR family Locus tag: Sama_3589 Name: SO1705 Funciton: hypothetical HlyD family secretion protein Locus tag: Sama_3588 Name: SO1706 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: Sama_3587 Name: SO1707 Funciton: ABC transporter, permease protein, putative
SO1703-SO1705-SO1706-SO1707	-33	5.8	TGTTCATCAAGAGAGGAATT	Sama_3590
Shewanella baltica OS155
Position: -35 Score: 6.56804 Sequence: TATTCATCAATAGATGAATT Locus tag: Sbal_1521 Name: SO1703 Funciton: Transcriptional regulator, TetR family Locus tag: Sbal_1522 Name: SO1705 Funciton: hypothetical HlyD family secretion protein Locus tag: Sbal_1523 Name: SO1706 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: Sbal_1524 Name: SO1707 Funciton: ABC transporter, permease protein, putative
SO1703-SO1705-SO1706-SO1707	-35	6.6	TATTCATCAATAGATGAATT	Sbal_1521
Shewanella putrefaciens CN-32
Position: -35 Score: 6.47532 Sequence: TATTCATCAGTAGATGAATT Locus tag: Sputcn32_1419 Name: SO1703 Funciton: Transcriptional regulator, TetR family Locus tag: Sputcn32_1420 Name: SO1705 Funciton: hypothetical HlyD family secretion protein Locus tag: Sputcn32_1421 Name: SO1706 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: Sputcn32_1422 Name: SO1707 Funciton: ABC transporter, permease protein, putative
SO1703-SO1705-SO1706-SO1707	-35	6.5	TATTCATCAGTAGATGAATT	Sputcn32_1419
Shewanella sp ANA-3
Position: -35 Score: 6.47532 Sequence: TATTCATCAGTAGATGAATT Locus tag: Shewana3_2751 Name: SO1703 Funciton: Transcriptional regulator, TetR family Locus tag: Shewana3_2750 Name: SO1705 Funciton: hypothetical HlyD family secretion protein Locus tag: Shewana3_2749 Name: SO1706 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: Shewana3_2748 Name: SO1707 Funciton: ABC transporter, permease protein, putative
SO1703-SO1705-SO1706-SO1707	-35	6.5	TATTCATCAGTAGATGAATT	Shewana3_2751
Shewanella sp MR-4
Position: -35 Score: 6.56804 Sequence: TATTCATCAATAGATGAATT Locus tag: Shewmr4_2576 Name: SO1703 Funciton: Transcriptional regulator, TetR family Locus tag: Shewmr4_2575 Name: SO1705 Funciton: hypothetical HlyD family secretion protein Locus tag: Shewmr4_2574 Name: SO1706 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: Shewmr4_2573 Name: SO1707 Funciton: ABC transporter, permease protein, putative
SO1703-SO1705-SO1706-SO1707	-35	6.6	TATTCATCAATAGATGAATT	Shewmr4_2576
Shewanella sp MR-7
Position: -35 Score: 6.56804 Sequence: TATTCATCAATAGATGAATT Locus tag: Shewmr7_2643 Name: SO1703 Funciton: Transcriptional regulator, TetR family Locus tag: Shewmr7_2642 Name: SO1705 Funciton: hypothetical HlyD family secretion protein Locus tag: Shewmr7_2641 Name: SO1706 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: Shewmr7_2640 Name: SO1707 Funciton: ABC transporter, permease protein, putative
SO1703-SO1705-SO1706-SO1707	-35	6.6	TATTCATCAATAGATGAATT	Shewmr7_2643
Shewanella sp W3-18-1
Position: -35 Score: 6.47532 Sequence: TATTCATCAGTAGATGAATT Locus tag: Sputw3181_2681 Name: SO1703 Funciton: Transcriptional regulator, TetR family Locus tag: Sputw3181_2680 Name: SO1705 Funciton: hypothetical HlyD family secretion protein Locus tag: Sputw3181_2679 Name: SO1706 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: Sputw3181_2678 Name: SO1707 Funciton: ABC transporter, permease protein, putative
SO1703-SO1705-SO1706-SO1707	-35	6.5	TATTCATCAGTAGATGAATT	Sputw3181_2681

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing SO1707 gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --