Orthologous regulated operons containing SO1706 gene
Regulog: | SO1703 - Shewanellaceae |
Regulator type: | Transcription factor |
Regulator family: | TetR |
Regulation mode: | repressor |
Biological process: | Multidrug resistance |
Effector: | |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Shewanella amazonensis SB2B | ||||
Position: -33
Score: 5.75835 Sequence: TGTTCATCAAGAGAGGAATT
Locus tag: Sama_3590
Name: SO1703 Funciton: Transcriptional regulator, TetR family
Locus tag: Sama_3589
Name: SO1705 Funciton: hypothetical HlyD family secretion protein
Locus tag: Sama_3588
Name: SO1706 Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: Sama_3587
Name: SO1707 Funciton: ABC transporter, permease protein, putative |
||||
SO1703-SO1705-SO1706-SO1707 | -33 | 5.8 | TGTTCATCAAGAGAGGAATT | Sama_3590 |
Shewanella baltica OS155 | ||||
Position: -35
Score: 6.56804 Sequence: TATTCATCAATAGATGAATT
Locus tag: Sbal_1521
Name: SO1703 Funciton: Transcriptional regulator, TetR family
Locus tag: Sbal_1522
Name: SO1705 Funciton: hypothetical HlyD family secretion protein
Locus tag: Sbal_1523
Name: SO1706 Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: Sbal_1524
Name: SO1707 Funciton: ABC transporter, permease protein, putative |
||||
SO1703-SO1705-SO1706-SO1707 | -35 | 6.6 | TATTCATCAATAGATGAATT | Sbal_1521 |
Shewanella putrefaciens CN-32 | ||||
Position: -35
Score: 6.47532 Sequence: TATTCATCAGTAGATGAATT
Locus tag: Sputcn32_1419
Name: SO1703 Funciton: Transcriptional regulator, TetR family
Locus tag: Sputcn32_1420
Name: SO1705 Funciton: hypothetical HlyD family secretion protein
Locus tag: Sputcn32_1421
Name: SO1706 Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: Sputcn32_1422
Name: SO1707 Funciton: ABC transporter, permease protein, putative |
||||
SO1703-SO1705-SO1706-SO1707 | -35 | 6.5 | TATTCATCAGTAGATGAATT | Sputcn32_1419 |
Shewanella sp ANA-3 | ||||
Position: -35
Score: 6.47532 Sequence: TATTCATCAGTAGATGAATT
Locus tag: Shewana3_2751
Name: SO1703 Funciton: Transcriptional regulator, TetR family
Locus tag: Shewana3_2750
Name: SO1705 Funciton: hypothetical HlyD family secretion protein
Locus tag: Shewana3_2749
Name: SO1706 Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: Shewana3_2748
Name: SO1707 Funciton: ABC transporter, permease protein, putative |
||||
SO1703-SO1705-SO1706-SO1707 | -35 | 6.5 | TATTCATCAGTAGATGAATT | Shewana3_2751 |
Shewanella sp MR-4 | ||||
Position: -35
Score: 6.56804 Sequence: TATTCATCAATAGATGAATT
Locus tag: Shewmr4_2576
Name: SO1703 Funciton: Transcriptional regulator, TetR family
Locus tag: Shewmr4_2575
Name: SO1705 Funciton: hypothetical HlyD family secretion protein
Locus tag: Shewmr4_2574
Name: SO1706 Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: Shewmr4_2573
Name: SO1707 Funciton: ABC transporter, permease protein, putative |
||||
SO1703-SO1705-SO1706-SO1707 | -35 | 6.6 | TATTCATCAATAGATGAATT | Shewmr4_2576 |
Shewanella sp MR-7 | ||||
Position: -35
Score: 6.56804 Sequence: TATTCATCAATAGATGAATT
Locus tag: Shewmr7_2643
Name: SO1703 Funciton: Transcriptional regulator, TetR family
Locus tag: Shewmr7_2642
Name: SO1705 Funciton: hypothetical HlyD family secretion protein
Locus tag: Shewmr7_2641
Name: SO1706 Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: Shewmr7_2640
Name: SO1707 Funciton: ABC transporter, permease protein, putative |
||||
SO1703-SO1705-SO1706-SO1707 | -35 | 6.6 | TATTCATCAATAGATGAATT | Shewmr7_2643 |
Shewanella sp W3-18-1 | ||||
Position: -35
Score: 6.47532 Sequence: TATTCATCAGTAGATGAATT
Locus tag: Sputw3181_2681
Name: SO1703 Funciton: Transcriptional regulator, TetR family
Locus tag: Sputw3181_2680
Name: SO1705 Funciton: hypothetical HlyD family secretion protein
Locus tag: Sputw3181_2679
Name: SO1706 Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: Sputw3181_2678
Name: SO1707 Funciton: ABC transporter, permease protein, putative |
||||
SO1703-SO1705-SO1706-SO1707 | -35 | 6.5 | TATTCATCAGTAGATGAATT | Sputw3181_2681 |