Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing SO1705 gene

Properties
Regulog: SO1703 - Shewanellaceae
Regulator type: Transcription factor
Regulator family: TetR
Regulation mode: repressor
Biological process: Multidrug resistance
Effector:
Phylum: Proteobacteria/gamma
Built upon 11 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Shewanella amazonensis SB2B
Position: -33
Score: 5.75835
Sequence: TGTTCATCAAGAGAGGAATT
Locus tag: Sama_3590
Name: SO1703
Funciton: Transcriptional regulator, TetR family
Locus tag: Sama_3589
Name: SO1705
Funciton: hypothetical HlyD family secretion protein
Locus tag: Sama_3588
Name: SO1706
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: Sama_3587
Name: SO1707
Funciton: ABC transporter, permease protein, putative
SO1703-SO1705-SO1706-SO1707 -33 5.8 TGTTCATCAAGAGAGGAATT Sama_3590
Shewanella baltica OS155
Position: -35
Score: 6.56804
Sequence: TATTCATCAATAGATGAATT
Locus tag: Sbal_1521
Name: SO1703
Funciton: Transcriptional regulator, TetR family
Locus tag: Sbal_1522
Name: SO1705
Funciton: hypothetical HlyD family secretion protein
Locus tag: Sbal_1523
Name: SO1706
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: Sbal_1524
Name: SO1707
Funciton: ABC transporter, permease protein, putative
SO1703-SO1705-SO1706-SO1707 -35 6.6 TATTCATCAATAGATGAATT Sbal_1521
Shewanella oneidensis MR-1
Position: -35
Score: 6.47532
Sequence: TATTCATCAGTAGATGAATT
Locus tag: SO_1703
Name: SO1703
Funciton: Transcriptional regulator, TetR family
Locus tag: SO_1705
Name: SO1705
Funciton: hypothetical HlyD family secretion protein
SO1703-SO1705 -35 6.5 TATTCATCAGTAGATGAATT SO_1703
Shewanella putrefaciens CN-32
Position: -35
Score: 6.47532
Sequence: TATTCATCAGTAGATGAATT
Locus tag: Sputcn32_1419
Name: SO1703
Funciton: Transcriptional regulator, TetR family
Locus tag: Sputcn32_1420
Name: SO1705
Funciton: hypothetical HlyD family secretion protein
Locus tag: Sputcn32_1421
Name: SO1706
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: Sputcn32_1422
Name: SO1707
Funciton: ABC transporter, permease protein, putative
SO1703-SO1705-SO1706-SO1707 -35 6.5 TATTCATCAGTAGATGAATT Sputcn32_1419
Shewanella sp ANA-3
Position: -35
Score: 6.47532
Sequence: TATTCATCAGTAGATGAATT
Locus tag: Shewana3_2751
Name: SO1703
Funciton: Transcriptional regulator, TetR family
Locus tag: Shewana3_2750
Name: SO1705
Funciton: hypothetical HlyD family secretion protein
Locus tag: Shewana3_2749
Name: SO1706
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: Shewana3_2748
Name: SO1707
Funciton: ABC transporter, permease protein, putative
SO1703-SO1705-SO1706-SO1707 -35 6.5 TATTCATCAGTAGATGAATT Shewana3_2751
Shewanella sp MR-4
Position: -35
Score: 6.56804
Sequence: TATTCATCAATAGATGAATT
Locus tag: Shewmr4_2576
Name: SO1703
Funciton: Transcriptional regulator, TetR family
Locus tag: Shewmr4_2575
Name: SO1705
Funciton: hypothetical HlyD family secretion protein
Locus tag: Shewmr4_2574
Name: SO1706
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: Shewmr4_2573
Name: SO1707
Funciton: ABC transporter, permease protein, putative
SO1703-SO1705-SO1706-SO1707 -35 6.6 TATTCATCAATAGATGAATT Shewmr4_2576
Shewanella sp MR-7
Position: -35
Score: 6.56804
Sequence: TATTCATCAATAGATGAATT
Locus tag: Shewmr7_2643
Name: SO1703
Funciton: Transcriptional regulator, TetR family
Locus tag: Shewmr7_2642
Name: SO1705
Funciton: hypothetical HlyD family secretion protein
Locus tag: Shewmr7_2641
Name: SO1706
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: Shewmr7_2640
Name: SO1707
Funciton: ABC transporter, permease protein, putative
SO1703-SO1705-SO1706-SO1707 -35 6.6 TATTCATCAATAGATGAATT Shewmr7_2643
Shewanella sp W3-18-1
Position: -35
Score: 6.47532
Sequence: TATTCATCAGTAGATGAATT
Locus tag: Sputw3181_2681
Name: SO1703
Funciton: Transcriptional regulator, TetR family
Locus tag: Sputw3181_2680
Name: SO1705
Funciton: hypothetical HlyD family secretion protein
Locus tag: Sputw3181_2679
Name: SO1706
Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: Sputw3181_2678
Name: SO1707
Funciton: ABC transporter, permease protein, putative
SO1703-SO1705-SO1706-SO1707 -35 6.5 TATTCATCAGTAGATGAATT Sputw3181_2681