Orthologous regulated operons containing pnuC gene
| Regulog: | PnuR - Shewanellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | activator |
| Biological process: | NAD biosynthesis |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Shewanella baltica OS155 | ||||
|
Position: -83
Score: 4.46385 Sequence: AAAGGGACAAAAGTCCGTTT
Locus tag: Sbal_3795
Name: pnuC Funciton: Ribosyl nicotinamide transporter, PnuC-like
Locus tag: Sbal_3794
Name: nmrP Funciton: N-Ribosylnicotinamide phosphorylase (EC 2.4.2.1), predicted |
||||
| pnuC-nmrP | -83 | 4.5 | AAAGGGACAAAAGTCCGTTT | Sbal_3795 |