Orthologous regulated operons containing hutD gene
Regulog: | HutC - Pseudomonadaceae |
Regulator type: | Transcription factor |
Regulator family: | GntR/Others |
Regulation mode: | repressor |
Biological process: | Histidine utilization |
Effector: | cis-Urocanic acid |
Phylum: | Proteobacteria/gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Pseudomonas aeruginosa PAO1 | ||||
Position: -77
Score: 5.40882 Sequence: TTATTTGTATATACATATAC
Locus tag: PA5105
Name: hutC Funciton: Histidine utilization repressor, GntR family
Locus tag: PA5104
Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation |
||||
hutC-hutD | -77 | 5.4 | TTATTTGTATATACATATAC | PA5105 |
Pseudomonas entomophila L48 | ||||
Position: -88
Score: 5.24889 Sequence: CAACTTGTATATACATATAC
Locus tag: PSEEN5099
Name: hutC Funciton: Histidine utilization repressor, GntR family
Locus tag: PSEEN5098
Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation |
||||
hutC-hutD | -88 | 5.2 | CAACTTGTATATACATATAC | PSEEN5099 |
Pseudomonas fluorescens Pf-5 | ||||
Position: -85
Score: 5.40882 Sequence: TTATTTGTATATACATATAC
Locus tag: PFL_0399
Name: hutC Funciton: Histidine utilization repressor, GntR family
Locus tag: PFL_0400
Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation |
||||
hutC-hutD | -85 | 5.4 | TTATTTGTATATACATATAC | PFL_0399 |
Pseudomonas putida KT2440 | ||||
Position: -88
Score: 5.45516 Sequence: TAACTTGTATATACATATAC
Locus tag: PP5035
Name: hutC Funciton: Histidine utilization repressor, GntR family
Locus tag: PP5034
Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation |
||||
hutC-hutD | -88 | 5.5 | TAACTTGTATATACATATAC | PP5035 |
Pseudomonas syringae pv. tomato str. DC3000 | ||||
Position: -142
Score: 5.25468 Sequence: TAATTTGTATATACATATAC
Locus tag: PSPTO5172
Name: hutC Funciton: Histidine utilization repressor, GntR family
Locus tag: PSPTO5173
Name: hutD Funciton: Conserved hypothetical protein related to histidine degradation |
||||
hutC-hutD | -142 | 5.3 | TAATTTGTATATACATATAC | PSPTO5172 |