Orthologous regulated operons containing hisP gene
| Regulog: | HutC - Burkholderia |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Histidine utilization |
| Effector: | cis-Urocanic acid |
| Phylum: | Proteobacteria/beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Burkholderia cepacia AMMD | ||||
|
Position: -113
Score: 5.28392 Sequence: AAAGTTGTATGTACAACTTG
Locus tag: Bamb_5463
Name: hisJ Funciton: Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1)
Locus tag: Bamb_5464
Name: hisQ Funciton: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1)
Locus tag: Bamb_5465
Name: hisM Funciton: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1)
Locus tag: Bamb_5466
Name: hisP Funciton: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1) |
||||
| hisJ-hisQ-hisM-hisP | -113 | 5.3 | AAAGTTGTATGTACAACTTG | Bamb_5463 |
| Burkholderia mallei ATCC 23344 | ||||
|
Position: -140
Score: 5.14852 Sequence: AAAGTTGTACATACAACTTC
Locus tag: BMAA1240
Name: hisQ Funciton: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1)
Locus tag: BMAA1239
Name: hisM Funciton: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1)
Locus tag: BMAA1238
Name: hisP Funciton: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1) |
||||
| hisQ-hisM-hisP | -140 | 5.1 | AAAGTTGTACATACAACTTC | BMAA1240 |
| Burkholderia pseudomallei K96243 | ||||
|
Position: -140
Score: 5.14852 Sequence: AAAGTTGTACATACAACTTC
Locus tag: BPSS0981
Name: hisQ Funciton: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1)
Locus tag: BPSS0982
Name: hisM Funciton: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1)
Locus tag: BPSS0983
Name: hisP Funciton: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1) |
||||
| hisQ-hisM-hisP | -140 | 5.1 | AAAGTTGTACATACAACTTC | BPSS0981 |
| Burkholderia sp. 383 | ||||
|
Position: -141
Score: 5.28392 Sequence: AAAGTTGTATGTACAACTTG
Locus tag: Bcep18194_B2378
Name: hisJ Funciton: Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1)
Locus tag: Bcep18194_B2377
Name: hisQ Funciton: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1)
Locus tag: Bcep18194_B2376
Name: hisM Funciton: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1)
Locus tag: Bcep18194_B2375
Name: hisP Funciton: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1) |
||||
| hisJ-hisQ-hisM-hisP | -141 | 5.3 | AAAGTTGTATGTACAACTTG | Bcep18194_B2378 |