Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing hisJ gene

Properties
Regulog: HutC - Burkholderia
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Phylum: Proteobacteria/beta
Built upon 46 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Burkholderia cepacia AMMD
Position: -113
Score: 5.28392
Sequence: AAAGTTGTATGTACAACTTG
Locus tag: Bamb_5463
Name: hisJ
Funciton: Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1)
Locus tag: Bamb_5464
Name: hisQ
Funciton: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1)
Locus tag: Bamb_5465
Name: hisM
Funciton: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1)
Locus tag: Bamb_5466
Name: hisP
Funciton: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1)
hisJ-hisQ-hisM-hisP -113 5.3 AAAGTTGTATGTACAACTTG Bamb_5463
Burkholderia sp. 383
Position: -141
Score: 5.28392
Sequence: AAAGTTGTATGTACAACTTG
Locus tag: Bcep18194_B2378
Name: hisJ
Funciton: Histidine ABC transporter, histidine-binding periplasmic protein precursor HisJ (TC 3.A.1.3.1)
Locus tag: Bcep18194_B2377
Name: hisQ
Funciton: Histidine ABC transporter, permease protein HisQ (TC 3.A.1.3.1)
Locus tag: Bcep18194_B2376
Name: hisM
Funciton: Histidine ABC transporter, permease protein HisM (TC 3.A.1.3.1)
Locus tag: Bcep18194_B2375
Name: hisP
Funciton: Histidine ABC transporter, ATP-binding protein HisP (TC 3.A.1.3.1)
hisJ-hisQ-hisM-hisP -141 5.3 AAAGTTGTATGTACAACTTG Bcep18194_B2378