Orthologous regulated operons containing PF08856 gene

Properties
Regulog:	Zur - Oceanospirillales/Alteromonadales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Proteobacteria/gamma

Built upon 51 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Reinekea sp. MED297
Position: -124 Score: 5.38642 Sequence: TAAATGATATGATGTATCATAAC Position: -119 Score: 5.15138 Sequence: GATATGATGTATCATAACAAATA Locus tag: MED297_11285 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: MED297_11290 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: MED297_11295 Name: yciC Funciton: Putative metal chaperone, GTPase of COG0523 family Locus tag: MED297_11300 Name: PF08856 Funciton: hypothetical protein Locus tag: MED297_11305 Name: zur Funciton: Zinc uptake regulation protein ZUR
znuC-znuB-yciC-PF08856-zur	-124	5.4	TAAATGATATGATGTATCATAAC	MED297_11285
	-119	5.2	GATATGATGTATCATAACAAATA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --