Orthologous regulated operons containing znuB gene

Properties
Regulog:	Zur - Oceanospirillales/Alteromonadales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Proteobacteria/gamma

Built upon 51 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Cellvibrio japonicus Ueda107
Position: -53 Score: 5.27147 Sequence: GAAAGGTTATAGAGTAACATAAC Locus tag: CJA_3482 Name: zur Funciton: Zinc uptake regulation protein ZUR Locus tag: CJA_3483 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: CJA_3484 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuC-znuB	-53	5.3	GAAAGGTTATAGAGTAACATAAC	CJA_3482
Chromohalobacter salexigens DSM 3043
Position: -56 Score: 5.86682 Sequence: AAAGAGTTATGTTATAACATATA Locus tag: Csal_0189 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Csal_0190 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
znuC-znuB	-56	5.9	AAAGAGTTATGTTATAACATATA	Csal_0189
Hahella chejuensis KCTC 2396
Position: -80 Score: 5.34799 Sequence: CAATTGTTATAACATTACACTTC Locus tag: HCH_00537 Name: zur Funciton: Zinc uptake regulation protein ZUR Locus tag: HCH_00536 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: HCH_00535 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuC-znuB	-80	5.3	CAATTGTTATAACATTACACTTC	HCH_00537
Marinobacter sp. ELB17
Position: -102 Score: 5.5346 Sequence: TGAACGTTATGTTATAACATTGC Locus tag: MELB17_12886 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: MELB17_12881 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
znuC-znuB	-102	5.5	TGAACGTTATGTTATAACATTGC	MELB17_12886
Marinomonas sp. MWYL1
Position: -51 Score: 5.20792 Sequence: TACTTGTTATATCATAACAAAAT Locus tag: Mmwyl1_0291 Name: null Funciton: putative membrane protein Locus tag: Mmwyl1_0292 Name: zur Funciton: Zinc uptake regulation protein ZUR Locus tag: Mmwyl1_0293 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Mmwyl1_0294 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Mmwyl1_0291-zur-znuC-znuB	-51	5.2	TACTTGTTATATCATAACAAAAT	Mmwyl1_0291
Oceanospirillum sp. MED92
Position: -43 Score: 5.60068 Sequence: TTAAAGTTACAATATAACACAAA Locus tag: MED92_05843 Name: zur Funciton: Zinc uptake regulation protein ZUR Locus tag: MED92_05838 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: MED92_05833 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuC-znuB	-43	5.6	TTAAAGTTACAATATAACACAAA	MED92_05843
Reinekea sp. MED297
Position: -124 Score: 5.38642 Sequence: TAAATGATATGATGTATCATAAC Position: -119 Score: 5.15138 Sequence: GATATGATGTATCATAACAAATA Locus tag: MED297_11285 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: MED297_11290 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: MED297_11295 Name: yciC Funciton: Putative metal chaperone, GTPase of COG0523 family Locus tag: MED297_11300 Name: PF08856 Funciton: hypothetical protein Locus tag: MED297_11305 Name: zur Funciton: Zinc uptake regulation protein ZUR
znuC-znuB-yciC-PF08856-zur	-124	5.4	TAAATGATATGATGTATCATAAC	MED297_11285
	-119	5.2	GATATGATGTATCATAACAAATA
Saccharophagus degradans 2-40
Position: -51 Score: 6.05745 Sequence: AAAGTGTTATATGATAACATAAC Locus tag: Sde_0059 Name: zur Funciton: Zinc uptake regulation protein ZUR Locus tag: Sde_0058 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Sde_0057 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuC-znuB	-51	6.1	AAAGTGTTATATGATAACATAAC	Sde_0059
Teredinibacter turnerae T7901
Position: -51 Score: 5.95491 Sequence: TAAACGTTATATGATAACATAAC Locus tag: TERTU_0053 Name: zur Funciton: Zinc uptake regulation protein ZUR Locus tag: TERTU_0052 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: TERTU_0051 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur-znuC-znuB	-51	6	TAAACGTTATATGATAACATAAC	TERTU_0053

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing znuB gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --