Orthologous regulated operons containing xltR gene
| Regulog: | XltR - Shewanellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Xylitol utilization |
| Effector: | Xylitol |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Shewanella halifaxensis HAW-EB4 | ||||
|
Position: -312
Score: 6.02264 Sequence: TTATGTTATCGATGTCATTA
Position: -148
Score: 6.28991 Sequence: AAATGACATCGATAACATTT
Locus tag: Shal_2007
Name: xltR Funciton: Transcriptional regulator of xylitol utilization, LacI family |
||||
| xltR | -312 | 6 | TTATGTTATCGATGTCATTA | Shal_2007 |
| -148 | 6.3 | AAATGACATCGATAACATTT | ||
| Shewanella pealeana ATCC 700345 | ||||
|
Position: -309
Score: 5.8569 Sequence: CAATGTTATCGATGTCATTA
Position: -147
Score: 6.77856 Sequence: AAATGTTATCGATAACATTT
Locus tag: Spea_2287
Name: xltR Funciton: Transcriptional regulator of xylitol utilization, LacI family |
||||
| xltR | -309 | 5.9 | CAATGTTATCGATGTCATTA | Spea_2287 |
| -147 | 6.8 | AAATGTTATCGATAACATTT | ||