Orthologous regulated operons containing xltA gene
| Regulog: | XltR - Shewanellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Xylitol utilization |
| Effector: | Xylitol |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Shewanella halifaxensis HAW-EB4 | ||||
|
Position: -206
Score: 6.28991 Sequence: AAATGTTATCGATGTCATTT
Position: -42
Score: 6.02264 Sequence: TAATGACATCGATAACATAA
Locus tag: Shal_2008
Name: xltF Funciton: Xylitol dehydrogenase (EC 1.1.1.9)
Locus tag: Shal_2009
Name: xylB Funciton: Xylulose kinase (EC 2.7.1.17)
Locus tag: Shal_2010
Name: xltA Funciton: Xylitol ABC transporter, ATP-binding component
Locus tag: Shal_2011
Name: xltB Funciton: Xylitol ABC transporter, permease component
Locus tag: Shal_2012
Name: xltC Funciton: Xylitol ABC transporter, periplasmic substrate-binding protein |
||||
| xltF-xylB-xltA-xltB-xltC | -206 | 6.3 | AAATGTTATCGATGTCATTT | Shal_2008 |
| -42 | 6 | TAATGACATCGATAACATAA | ||
| Shewanella pealeana ATCC 700345 | ||||
|
Position: -204
Score: 6.77856 Sequence: AAATGTTATCGATAACATTT
Position: -42
Score: 5.8569 Sequence: TAATGACATCGATAACATTG
Locus tag: Spea_2286
Name: xltF Funciton: Xylitol dehydrogenase (EC 1.1.1.9)
Locus tag: Spea_2285
Name: xylB Funciton: Xylulose kinase (EC 2.7.1.17)
Locus tag: Spea_2284
Name: xltA Funciton: Xylitol ABC transporter, ATP-binding component
Locus tag: Spea_2283
Name: xltB Funciton: Xylitol ABC transporter, permease component
Locus tag: Spea_2282
Name: xltC Funciton: Xylitol ABC transporter, periplasmic substrate-binding protein |
||||
| xltF-xylB-xltA-xltB-xltC | -204 | 6.8 | AAATGTTATCGATAACATTT | Spea_2286 |
| -42 | 5.9 | TAATGACATCGATAACATTG | ||