Orthologous regulated operons containing ytrB gene
Regulog: | YtrA - Bacillales |
Regulator type: | Transcription factor |
Regulator family: | GntR/Others |
Regulation mode: | repressor |
Biological process: | Ramoplanin resistance |
Effector: | Ramoplanin |
Phylum: | Firmicutes |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Anoxybacillus flavithermus WK1 | ||||
Position: -60
Score: 6.09431 Sequence: CGTATTATTTAATATAATACA
Locus tag: Aflv_1397
Name: ytrA Funciton: Transcriptional regulator, GntR family
Locus tag: Aflv_1398
Name: ytrB Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: Aflv_1399
Name: ytrC Funciton: ABC-type multidrug transport system, permease component |
||||
ytrA-ytrB-ytrC | -60 | 6.1 | CGTATTATTTAATATAATACA | Aflv_1397 |
Bacillus amyloliquefaciens FZB42 | ||||
Position: -238
Score: 6.72078 Sequence: TGTACTACTTGATGTAATACA
Locus tag: RBAM_027400
Name: ytrA Funciton: Transcriptional regulator, GntR family
Locus tag: RBAM_027390
Name: ytrB Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: RBAM_027380
Name: ytrC Funciton: ABC-type multidrug transport system, permease component
Locus tag: RBAM_027370
Name: ytrC Funciton: ABC-type multidrug transport system, permease component
Locus tag: RBAM_027360
Name: ytrC Funciton: ABC-type multidrug transport system, permease component
Locus tag: RBAM_027350
Name: ytrE Funciton: ABC transporter, ATP-binding protein
Locus tag: RBAM_027340
Name: ytrF Funciton: ABC transporter, permease protein |
||||
ytrA-ytrB-ytrC-ytrC-ytrC-ytrE-ytrF | -238 | 6.7 | TGTACTACTTGATGTAATACA | RBAM_027400 |
Bacillus cereus ATCC 14579 | ||||
Position: -46
Score: 6.39889 Sequence: TGTATTACATATAGTAGTACA
Locus tag: BC4076
Name: ytrA Funciton: Transcriptional regulator, GntR family
Locus tag: BC4077
Name: ytrB Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: BC4078
Name: ytrC Funciton: ABC-type multidrug transport system, permease component
Locus tag: BC4079
Name: ytrC Funciton: ABC-type multidrug transport system, permease component |
||||
ytrA-ytrB-ytrC-ytrC | -46 | 6.4 | TGTATTACATATAGTAGTACA | BC4076 |
Bacillus licheniformis DSM 13 | ||||
Position: -223
Score: 6.39037 Sequence: TGTACTACATCGAGTAATACA
Locus tag: BLi03185
Name: ytrA Funciton: Transcriptional regulator, GntR family
Locus tag: BLi03184
Name: ytrB Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: BLi03183
Name: ytrC Funciton: ABC-type multidrug transport system, permease component
Locus tag: BLi03182
Name: ytrE Funciton: ABC transporter, ATP-binding protein
Locus tag: BLi03181
Name: ytrF Funciton: ABC transporter, permease protein |
||||
ytrA-ytrB-ytrC-ytrE-ytrF | -223 | 6.4 | TGTACTACATCGAGTAATACA | BLi03185 |
Bacillus pumilus SAFR-032 | ||||
Position: -234
Score: 6.42666 Sequence: TGTACTACATCAACTAATACA
Locus tag: BPUM_2677
Name: ytrA Funciton: Transcriptional regulator, GntR family
Locus tag: BPUM_2676
Name: ytrB Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: BPUM_2675
Name: ytrC Funciton: ABC-type multidrug transport system, permease component
Locus tag: BPUM_2674
Name: ytrE Funciton: ABC transporter, ATP-binding protein
Locus tag: BPUM_2673
Name: ytrF Funciton: ABC transporter, permease protein |
||||
ytrA-ytrB-ytrC-ytrE-ytrF | -234 | 6.4 | TGTACTACATCAACTAATACA | BPUM_2677 |
Bacillus subtilis subsp. subtilis str. 168 | ||||
Position: -244
Score: 6.47264 Sequence: TGTACTAATTGAAGTAATACA
Locus tag: BSU30460
Name: ytrA Funciton: Transcriptional regulator, GntR family
Locus tag: BSU30450
Name: ytrB Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: BSU30440
Name: ytrC Funciton: ABC-type multidrug transport system, permease component
Locus tag: BSU30430
Name: ytrC Funciton: ABC-type multidrug transport system, permease component
Locus tag: BSU30420
Name: ytrE Funciton: ABC transporter, ATP-binding protein
Locus tag: BSU30410
Name: ytrF Funciton: ABC transporter, permease protein |
||||
ytrA-ytrB-ytrC-ytrC-ytrE-ytrF | -244 | 6.5 | TGTACTAATTGAAGTAATACA | BSU30460 |
Geobacillus kaustophilus HTA426 | ||||
Position: -49
Score: 5.85254 Sequence: TGTACTATTAGTTATAGTACG
Locus tag: GK1620
Name: ytrA Funciton: Transcriptional regulator, GntR family
Locus tag: GK1621
Name: ytrB Funciton: ABC-type multidrug transport system, ATPase component
Locus tag: GK1622
Name: ytrC Funciton: ABC-type multidrug transport system, permease component |
||||
ytrA-ytrB-ytrC | -49 | 5.9 | TGTACTATTAGTTATAGTACG | GK1620 |