Orthologous regulated operons containing exbB gene
| Regulog: | Zur - Moraxellaceae |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Proteobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Acinetobacter sp. ADP1 | ||||
|
Position: -253
Score: 5.70807 Sequence: AAAGTATTATGTTATAACATAAT
Locus tag: ACIAD0507
Name: tonB Funciton: Ferric siderophore transport system, periplasmic binding protein TonB
Locus tag: ACIAD0508
Name: exbB Funciton: MotA/TolQ/ExbB proton channel family protein
Locus tag: ACIAD0509
Name: exbD Funciton: Biopolymer transport protein ExbD/TolR |
||||
| tonB-exbB-exbD | -253 | 5.7 | AAAGTATTATGTTATAACATAAT | ACIAD0507 |