Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing VC2555 gene

Properties
Regulog: Zur - Vibrionales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Proteobacteria/gamma
Built upon 62 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Photobacterium profundum SS9
Position: -376
Score: 6.16298
Sequence: GTAATGTTATATTATTACATTAC
Locus tag: PBPRA0374
Name: zbp
Funciton: Predicted zinc-binding protein
Locus tag: PBPRA0373
Name: VV1_0719
Funciton: ABC-type antimicrobial peptide transport system, ATPase component
Locus tag: PBPRA0372
Name: VC2554
Funciton: ABC-type antimicrobial peptide transport system, permease component
Locus tag: PBPRA0371
Name: VC2555
Funciton: FIG003461: hypothetical protein
zbp-VV1_0719-VC2554-VC2555 -376 6.2 GTAATGTTATATTATTACATTAC PBPRA0374
Vibrio cholerae O1 biovar eltor str. N16961
Position: -50
Score: 5.14441
Sequence: GACTTGTTATATTATAACAAGCC
Locus tag: VC2551
Name: VC2551
Funciton: hypothetical protein
Locus tag: VC2552
Name: zbp
Funciton: Predicted zinc-binding protein
Locus tag: VC2553
Name: VV1_0719
Funciton: ABC-type antimicrobial peptide transport system, ATPase component
Locus tag: VC2554
Name: VC2554
Funciton: ABC-type antimicrobial peptide transport system, permease component
Locus tag: VC2555
Name: VC2555
Funciton: FIG003461: hypothetical protein
VC2551-zbp-VV1_0719-VC2554-VC2555 -50 5.1 GACTTGTTATATTATAACAAGCC VC2551
Vibrio fischeri ES114
Position: -389
Score: 6.37102
Sequence: AAAATGTTATATTATTACATTTA
Locus tag: VF_0328
Name: zbp
Funciton: Predicted zinc-binding protein
Locus tag: VF_0327
Name: VV1_0719
Funciton: ABC-type antimicrobial peptide transport system, ATPase component
Locus tag: VF_0326
Name: VC2554
Funciton: ABC-type antimicrobial peptide transport system, permease component
Locus tag: VF_0325
Name: VC2555
Funciton: FIG003461: hypothetical protein
zbp-VV1_0719-VC2554-VC2555 -389 6.4 AAAATGTTATATTATTACATTTA VF_0328
Vibrio parahaemolyticus RIMD 2210633
Position: -43
Score: 5.26494
Sequence: TGAGTGTTATATTATAACACCCG
Locus tag: VP0303
Name: VC2551
Funciton: hypothetical protein
Locus tag: VP0302
Name: zbp
Funciton: Predicted zinc-binding protein
Locus tag: VP0301
Name: VV1_0719
Funciton: ABC-type antimicrobial peptide transport system, ATPase component
Locus tag: VP0300
Name: VC2554
Funciton: ABC-type antimicrobial peptide transport system, permease component
Locus tag: VP0299
Name: VC2555
Funciton: FIG003461: hypothetical protein
VC2551-zbp-VV1_0719-VC2554-VC2555 -43 5.3 TGAGTGTTATATTATAACACCCG VP0303
Vibrio salmonicida LFI1238
Position: -390
Score: 6.37102
Sequence: AAAATGTTATATTATTACATTTA
Locus tag: VSAL_I0428
Name: zbp
Funciton: Predicted zinc-binding protein
Locus tag: VSAL_I0427
Name: VV1_0719
Funciton: ABC-type antimicrobial peptide transport system, ATPase component
Locus tag: VSAL_I0426
Name: VC2554
Funciton: ABC-type antimicrobial peptide transport system, permease component
Locus tag: VSAL_I0425
Name: VC2555
Funciton: FIG003461: hypothetical protein
zbp-VV1_0719-VC2554-VC2555 -390 6.4 AAAATGTTATATTATTACATTTA VSAL_I0428
Vibrio shilonii AK1
Position: -391
Score: 5.93767
Sequence: GATTTGTTATAACATAACAAATC
Locus tag: VSAK1_01829
Name: zbp
Funciton: Predicted zinc-binding protein
Locus tag: VSAK1_01824
Name: VV1_0719
Funciton: ABC-type antimicrobial peptide transport system, ATPase component
Locus tag: VSAK1_01819
Name: VC2554
Funciton: ABC-type antimicrobial peptide transport system, permease component
Locus tag: VSAK1_01814
Name: VC2555
Funciton: FIG003461: hypothetical protein
zbp-VV1_0719-VC2554-VC2555 -391 5.9 GATTTGTTATAACATAACAAATC VSAK1_01829
Vibrio splendidus LGP32
Position: -385
Score: 6.21452
Sequence: ATATTGTTATATTATAACAGTAT
Locus tag: VS_2781
Name: zbp
Funciton: Predicted zinc-binding protein
Locus tag: VS_2782
Name: VV1_0719
Funciton: ABC-type antimicrobial peptide transport system, ATPase component
Locus tag: VS_2783
Name: VC2554
Funciton: ABC-type antimicrobial peptide transport system, permease component
Locus tag: VS_2784
Name: VC2555
Funciton: FIG003461: hypothetical protein
zbp-VV1_0719-VC2554-VC2555 -385 6.2 ATATTGTTATATTATAACAGTAT VS_2781
Vibrio vulnificus CMCP6
Position: -381
Score: 5.58896
Sequence: TAGCTGTTATATTGTAACACTTT
Locus tag: VV1_0717
Name: zbp
Funciton: Predicted zinc-binding protein
Locus tag: VV1_0719
Name: VV1_0719
Funciton: ABC-type antimicrobial peptide transport system, ATPase component
Locus tag: VV1_0720
Name: VC2554
Funciton: ABC-type antimicrobial peptide transport system, permease component
Locus tag: VV1_0721
Name: VC2555
Funciton: FIG003461: hypothetical protein
zbp-VV1_0719-VC2554-VC2555 -381 5.6 TAGCTGTTATATTGTAACACTTT VV1_0717