Orthologous regulated operons containing zbp gene

Properties
Regulog:	Zur - Vibrionales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Proteobacteria/gamma

Built upon 62 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Photobacterium profundum SS9
Position: -376 Score: 6.16298 Sequence: GTAATGTTATATTATTACATTAC Locus tag: PBPRA0374 Name: zbp Funciton: Predicted zinc-binding protein Locus tag: PBPRA0373 Name: VV1_0719 Funciton: ABC-type antimicrobial peptide transport system, ATPase component Locus tag: PBPRA0372 Name: VC2554 Funciton: ABC-type antimicrobial peptide transport system, permease component Locus tag: PBPRA0371 Name: VC2555 Funciton: FIG003461: hypothetical protein
zbp-VV1_0719-VC2554-VC2555	-376	6.2	GTAATGTTATATTATTACATTAC	PBPRA0374
Vibrio cholerae O1 biovar eltor str. N16961
Position: -50 Score: 5.14441 Sequence: GACTTGTTATATTATAACAAGCC Locus tag: VC2551 Name: VC2551 Funciton: hypothetical protein Locus tag: VC2552 Name: zbp Funciton: Predicted zinc-binding protein Locus tag: VC2553 Name: VV1_0719 Funciton: ABC-type antimicrobial peptide transport system, ATPase component Locus tag: VC2554 Name: VC2554 Funciton: ABC-type antimicrobial peptide transport system, permease component Locus tag: VC2555 Name: VC2555 Funciton: FIG003461: hypothetical protein
VC2551-zbp-VV1_0719-VC2554-VC2555	-50	5.1	GACTTGTTATATTATAACAAGCC	VC2551
Vibrio fischeri ES114
Position: -389 Score: 6.37102 Sequence: AAAATGTTATATTATTACATTTA Locus tag: VF_0328 Name: zbp Funciton: Predicted zinc-binding protein Locus tag: VF_0327 Name: VV1_0719 Funciton: ABC-type antimicrobial peptide transport system, ATPase component Locus tag: VF_0326 Name: VC2554 Funciton: ABC-type antimicrobial peptide transport system, permease component Locus tag: VF_0325 Name: VC2555 Funciton: FIG003461: hypothetical protein
zbp-VV1_0719-VC2554-VC2555	-389	6.4	AAAATGTTATATTATTACATTTA	VF_0328
Vibrio parahaemolyticus RIMD 2210633
Position: -43 Score: 5.26494 Sequence: TGAGTGTTATATTATAACACCCG Locus tag: VP0303 Name: VC2551 Funciton: hypothetical protein Locus tag: VP0302 Name: zbp Funciton: Predicted zinc-binding protein Locus tag: VP0301 Name: VV1_0719 Funciton: ABC-type antimicrobial peptide transport system, ATPase component Locus tag: VP0300 Name: VC2554 Funciton: ABC-type antimicrobial peptide transport system, permease component Locus tag: VP0299 Name: VC2555 Funciton: FIG003461: hypothetical protein
VC2551-zbp-VV1_0719-VC2554-VC2555	-43	5.3	TGAGTGTTATATTATAACACCCG	VP0303
Vibrio salmonicida LFI1238
Position: -390 Score: 6.37102 Sequence: AAAATGTTATATTATTACATTTA Locus tag: VSAL_I0428 Name: zbp Funciton: Predicted zinc-binding protein Locus tag: VSAL_I0427 Name: VV1_0719 Funciton: ABC-type antimicrobial peptide transport system, ATPase component Locus tag: VSAL_I0426 Name: VC2554 Funciton: ABC-type antimicrobial peptide transport system, permease component Locus tag: VSAL_I0425 Name: VC2555 Funciton: FIG003461: hypothetical protein
zbp-VV1_0719-VC2554-VC2555	-390	6.4	AAAATGTTATATTATTACATTTA	VSAL_I0428
Vibrio shilonii AK1
Position: -391 Score: 5.93767 Sequence: GATTTGTTATAACATAACAAATC Locus tag: VSAK1_01829 Name: zbp Funciton: Predicted zinc-binding protein Locus tag: VSAK1_01824 Name: VV1_0719 Funciton: ABC-type antimicrobial peptide transport system, ATPase component Locus tag: VSAK1_01819 Name: VC2554 Funciton: ABC-type antimicrobial peptide transport system, permease component Locus tag: VSAK1_01814 Name: VC2555 Funciton: FIG003461: hypothetical protein
zbp-VV1_0719-VC2554-VC2555	-391	5.9	GATTTGTTATAACATAACAAATC	VSAK1_01829
Vibrio splendidus LGP32
Position: -385 Score: 6.21452 Sequence: ATATTGTTATATTATAACAGTAT Locus tag: VS_2781 Name: zbp Funciton: Predicted zinc-binding protein Locus tag: VS_2782 Name: VV1_0719 Funciton: ABC-type antimicrobial peptide transport system, ATPase component Locus tag: VS_2783 Name: VC2554 Funciton: ABC-type antimicrobial peptide transport system, permease component Locus tag: VS_2784 Name: VC2555 Funciton: FIG003461: hypothetical protein
zbp-VV1_0719-VC2554-VC2555	-385	6.2	ATATTGTTATATTATAACAGTAT	VS_2781
Vibrio vulnificus CMCP6
Position: -381 Score: 5.58896 Sequence: TAGCTGTTATATTGTAACACTTT Locus tag: VV1_0717 Name: zbp Funciton: Predicted zinc-binding protein Locus tag: VV1_0719 Name: VV1_0719 Funciton: ABC-type antimicrobial peptide transport system, ATPase component Locus tag: VV1_0720 Name: VC2554 Funciton: ABC-type antimicrobial peptide transport system, permease component Locus tag: VV1_0721 Name: VC2555 Funciton: FIG003461: hypothetical protein
zbp-VV1_0719-VC2554-VC2555	-381	5.6	TAGCTGTTATATTGTAACACTTT	VV1_0717

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing zbp gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --